Construct: ORF TRCN0000466557
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF008221.1_s317c1
- Derived from:
- ccsbBroadEn_04569
- DNA Barcode:
- GCGAAACTAATGCCATTTAAGAGA
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- OXNAD1 (92106)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000466557
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
---|---|---|---|---|---|---|---|---|
1 | human | 92106 | OXNAD1 | oxidoreductase NAD binding ... | NM_001352977.1 | 100% | 100% | |
2 | human | 92106 | OXNAD1 | oxidoreductase NAD binding ... | NM_001352978.2 | 100% | 100% | |
3 | human | 92106 | OXNAD1 | oxidoreductase NAD binding ... | NM_138381.5 | 100% | 100% | |
4 | human | 92106 | OXNAD1 | oxidoreductase NAD binding ... | XM_017007486.2 | 100% | 100% | |
5 | human | 92106 | OXNAD1 | oxidoreductase NAD binding ... | XM_017007487.2 | 100% | 100% | |
6 | human | 92106 | OXNAD1 | oxidoreductase NAD binding ... | XM_017007489.2 | 100% | 100% | |
7 | human | 92106 | OXNAD1 | oxidoreductase NAD binding ... | XM_017007491.2 | 100% | 100% | |
8 | human | 92106 | OXNAD1 | oxidoreductase NAD binding ... | XM_017007492.1 | 100% | 100% | |
9 | human | 92106 | OXNAD1 | oxidoreductase NAD binding ... | NM_001330670.2 | 94.5% | 94.5% | 1_54del |
10 | human | 92106 | OXNAD1 | oxidoreductase NAD binding ... | NM_001330671.3 | 94.5% | 94.5% | 1_54del |
11 | human | 92106 | OXNAD1 | oxidoreductase NAD binding ... | NM_001352980.1 | 84.5% | 78.5% | (many diffs) |
12 | human | 92106 | OXNAD1 | oxidoreductase NAD binding ... | NM_001352981.1 | 84.5% | 78.5% | (many diffs) |
13 | human | 92106 | OXNAD1 | oxidoreductase NAD binding ... | NM_001352982.2 | 84.5% | 78.5% | (many diffs) |
14 | human | 92106 | OXNAD1 | oxidoreductase NAD binding ... | NM_001352983.2 | 84.5% | 78.5% | (many diffs) |
15 | human | 92106 | OXNAD1 | oxidoreductase NAD binding ... | XM_017007493.2 | 84.5% | 78.5% | (many diffs) |
16 | human | 92106 | OXNAD1 | oxidoreductase NAD binding ... | XM_024453828.1 | 84.5% | 78.5% | (many diffs) |
17 | human | 92106 | OXNAD1 | oxidoreductase NAD binding ... | XM_005265559.4 | 81% | 81% | 1_219del |
18 | human | 92106 | OXNAD1 | oxidoreductase NAD binding ... | XM_011534230.3 | 81% | 81% | 1_219del |
19 | human | 92106 | OXNAD1 | oxidoreductase NAD binding ... | XM_011534233.3 | 81% | 81% | 1_219del |
20 | human | 92106 | OXNAD1 | oxidoreductase NAD binding ... | XM_011534234.3 | 81% | 81% | 1_219del |
21 | human | 92106 | OXNAD1 | oxidoreductase NAD binding ... | XM_011534235.3 | 81% | 81% | 1_219del |
22 | human | 92106 | OXNAD1 | oxidoreductase NAD binding ... | XR_940512.3 | 30.3% | 1_487del;1424_3089del | |
23 | human | 92106 | OXNAD1 | oxidoreductase NAD binding ... | XR_940511.3 | 30.1% | 1_487del;1424_3109del | |
24 | human | 92106 | OXNAD1 | oxidoreductase NAD binding ... | NR_148219.1 | 29.5% | 1_586del;770_843del;1597_3165del | |
25 | human | 92106 | OXNAD1 | oxidoreductase NAD binding ... | NR_148218.1 | 28.8% | 1_586del;770_946del;1700_3248del | |
26 | human | 92106 | OXNAD1 | oxidoreductase NAD binding ... | NR_148217.1 | 28.6% | 1_586del;770_946del;1700_3268del | |
27 | human | 92106 | OXNAD1 | oxidoreductase NAD binding ... | NR_148220.2 | 21.8% | 1_452del;636_709del;1463_4279del | |
28 | human | 92106 | OXNAD1 | oxidoreductase NAD binding ... | XR_001740364.2 | 21% | 1_487del;1424_4440del | |
29 | human | 92106 | OXNAD1 | oxidoreductase NAD binding ... | XR_001740365.2 | 13.4% | 1_474del;1411_6944del | |
30 | human | 92106 | OXNAD1 | oxidoreductase NAD binding ... | XR_002959607.1 | 9.3% | 1_468del;1405_10002del | |
31 | human | 92106 | OXNAD1 | oxidoreductase NAD binding ... | XR_002959608.1 | 9.3% | 1_474del;1411_10008del | |
32 | human | 92106 | OXNAD1 | oxidoreductase NAD binding ... | XR_002959606.1 | 9.3% | 1_487del;1424_10021del | |
33 | human | 92106 | OXNAD1 | oxidoreductase NAD binding ... | XR_002959609.1 | 9.1% | 1_474del;658_834del;1588_10185del |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 1002
- ORF length:
- 936
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatggc ctgtgctgct gttatgattc ctgggttgtt gcggtgctct gttggagcca 121 tccgtattga ggctgcgtca ctgagattga cactcagcac tttgcgccac cttactctaa 181 ccagcataat gaaatccaaa aggaaaactg atcacatgga gagaactgca agtgtccttc 241 gacgggagat tgtgtcagca gctaaggtgt gtggagctgc cagtgagtca ccgtcagtga 301 agagcctccg cttgcttgtt gctgatcaag acttttcctt taaagctggc cagtgggttg 361 atttctttat tccaggagtc tctgtggttg gtgggttttc aatatgctcc agtcccagac 421 tgctagaaca agagagagtg atagaattgg cagtgaaata tacgaaccac cctcctgccc 481 tctgggttca caatacgtgt acacttgact gtgaagtggc tgtgagagtg ggtggagagt 541 tcttctttga ccctcagcct gcggatgcct ctagaaacct cgtgttgatt gcaggaggag 601 tcggaattaa ccctctgctt tccatccTGC GGCACGCAGC AGATCTCCTC AGAGAGCAGG 661 CAAACAAAAG AAATGGATAT GAGATAGGAA CAATAAAACT ATTCTACAGT GCAAAAAATA 721 CCAGCGAACT CCTGTTTAAG AAAAATATCC TTGATTTAGT AAATGAATTT CCTGAGAAGA 781 TTGCATGCAG TTTGCATGTT ACAAAACAGA CTACACAAAT CAATGCGGAA CTCAAGCCAT 841 ACATCACGGA AGGAAGAATA ACGGAGAAGG AGATAAGAGA TCATATTTCA AAAGAGACTT 901 TGTTCTATAT TTGTGGCCCA CCTCCAATGA CAGACTTTTT CTCCAAGCAA CTGGAAAACA 961 ACCATGTACC CAAAGAACAC ATTTGCTTTG AGAAGTGGTG GTACCCAACT TTCTTGTACA 1021 AAGTGGTTGA TATCGGTAAG CCTATCCCTA ACCCTCTCCT CGGTCTCGAT TCTACGTAGT 1081 AATGAACTAG TCCGTAACTT GAAAGTATTT CGATTTCTTG GCTTTATATA TCTTGTGGAA 1141 AGGACGAGCG AAACTAATGC CATTTAAGAG AACGCGTTAA GTCgacaatc aacctctgga 1201 ttacaaaatt tgtgaaagat t