Construct: ORF TRCN0000466673
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF000421.1_s317c1
- Derived from:
- ccsbBroadEn_06373
- DNA Barcode:
- CAAGGAACCGACCGTTGGATTCAT
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- HLA-DQB1 (3119)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000466673
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- n/a
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 3119 | HLA-DQB1 | major histocompatibility co... | NM_001243962.1 | 95.7% | 92.7% | (many diffs) |
| 2 | human | 3119 | HLA-DQB1 | major histocompatibility co... | NM_002123.5 | 94.7% | 91.5% | (many diffs) |
| 3 | human | 3119 | HLA-DQB1 | major histocompatibility co... | NM_001243961.2 | 91.9% | 88.8% | (many diffs) |
| 4 | human | 3120 | HLA-DQB2 | major histocompatibility co... | XM_011514560.2 | 88.6% | 80.8% | (many diffs) |
| 5 | human | 3120 | HLA-DQB2 | major histocompatibility co... | NM_001300790.2 | 86% | 78.4% | (many diffs) |
| 6 | human | 3120 | HLA-DQB2 | major histocompatibility co... | XM_005249051.4 | 82.4% | 74.2% | (many diffs) |
| 7 | human | 3120 | HLA-DQB2 | major histocompatibility co... | NM_001198858.2 | 77.5% | 67.8% | (many diffs) |
| 8 | human | 3120 | HLA-DQB2 | major histocompatibility co... | XM_011514561.3 | 74.8% | 66.2% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 849
- ORF length:
- 783
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatgtc ttggaagaag gctttgcgga tccctggagg ccttcgggta gcaactgtga 121 ccttgatgct ggcgatgctg agcaccccgg tggctgaggg cagagactct cccgaggatt 181 tcgtgtacca gtttaagggc atgtgctact tcaccaacgg gacggagcgc gtgcgtcttg 241 tgaccagata catctataac cgagaggagt acgcacgctt cgacagcgac gtgggggtgt 301 atcgggcggt gacgccgctg gggccgcctg ccgccgagta ctggaacagc cagaaggaag 361 tcctggagag gacccgggcg gagttggaca cggtgtgcag acacaactac cagttggagc 421 tccgcacgac cttgcagcgg cgagtggagc ccacagtgac catctcccca tccaggacag 481 aggccctcaa ccaccacaac ctgctggtct gctcagtgac agatttctat ccagcccaga 541 tcaaagtccg gtggtttcgg aatgaccagg aggagacaac tGGCGTTGTG TCCACCCCCC 601 TTATTAGGAA CGGTGACTGG ACCTTCCAGA TCCTGGTGAT GCTGGAAATG ACTCCCCAGC 661 GTGGAGACGT CTACACCTGC CACGTGGAGC ACCCCAGCCT CCAGAACCCC ATCATCGTGG 721 AGTGGCGGGC TCAGTCTGAA TCTGCCCAGA GCAAGATGCT GAGTGGCATT GGAGGCTTCG 781 TGCTGGGGCT GATCTTCCTC GGGCTGGGCC TTATTATCCA TCACAGGAGT CAGAAAGGGC 841 TCCTGCACTG CCCAACTTTC TTGTACAAAG TGGTTGATAT CGGTAAGCCT ATCCCTAACC 901 CTCTCCTCGG TCTCGATTCT ACGTAGTAAT GAACTAGTCC GTAACTTGAA AGTATTTCGA 961 TTTCTTGGCT TTATATATCT TGTGGAAAGG ACGACAAGGA ACCGACCGTT GGATTCATAC 1021 GCGTTAAGTC gacaatcaac ctctggatta caaaatttgt gaaagatt