Transcript: Human NM_002123.5

Homo sapiens major histocompatibility complex, class II, DQ beta 1 (HLA-DQB1), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-09-29
Taxon:
Homo sapiens (human)
Gene:
HLA-DQB1 (3119)
Length:
1605
CDS:
51..836

Additional Resources:

NCBI RefSeq record:
NM_002123.5
NBCI Gene record:
HLA-DQB1 (3119)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_002123.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

No results found.

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_002123.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_06373 pDONR223 100% 94.7% 91.5% None (many diffs) n/a
2 ccsbBroad304_06373 pLX_304 0% 94.7% 91.5% V5 (many diffs) n/a
3 TRCN0000466673 CAAGGAACCGACCGTTGGATTCAT pLX_317 34.6% 94.7% 91.5% V5 (many diffs) n/a
4 ccsbBroadEn_10881 pDONR223 100% 76.2% 67.4% None (many diffs) n/a
5 ccsbBroad304_10881 pLX_304 0% 76.2% 67.4% V5 (many diffs) n/a
6 TRCN0000469612 CAGTTAAGCTATTAAATCGTGGCT pLX_317 67.6% 76.2% 67.4% V5 (many diffs) n/a
Download CSV