Construct: ORF TRCN0000466714
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF016919.1_s317c1
- Derived from:
- ccsbBroadEn_07543
- DNA Barcode:
- ACTCAACAAGTCCTCTCTCATGTT
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- SCAMP3 (10067)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000466714
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- n/a
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 10067 | SCAMP3 | secretory carrier membrane ... | NM_005698.4 | 99.9% | 99.7% | 378G>N |
| 2 | human | 10067 | SCAMP3 | secretory carrier membrane ... | NM_052837.3 | 92.4% | 92.2% | 64_65ins78;300G>N |
| 3 | mouse | 24045 | Scamp3 | secretory carrier membrane ... | NM_011886.3 | 87.8% | 89.9% | (many diffs) |
| 4 | mouse | 24045 | Scamp3 | secretory carrier membrane ... | NM_001309909.1 | 87.5% | 89.7% | (many diffs) |
| 5 | mouse | 24045 | Scamp3 | secretory carrier membrane ... | NM_001309910.1 | 78.6% | 80.5% | (many diffs) |
| 6 | mouse | 105943584 | Gm45927 | predicted gene, 45927 | NM_001310017.1 | 56.4% | 55.4% | (many diffs) |
| 7 | mouse | 105943584 | Gm45927 | predicted gene, 45927 | NM_001310016.1 | 39.6% | 39% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 1107
- ORF length:
- 1041
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatggc tcagagcaga gacggcggaa acccgttcgc cgagcccagc gagcttgaca 121 acccctttca ggacccagct gtgatccagc accgacccag ccggcagtat gccacgcttg 181 acgtctacaa cccttttgag acccgggagc caccaccagc ctatgagcct ccagcccctg 241 ccccattgcc tccaccctca gctccctcct tgcagccctc gagaaagctc agccccacag 301 aacctaagaa ctatggctca tacagcactc aggcctcagc tgcagcagcc acagctgagc 361 tgctgaagaa acaggaggag ctcaaccgga aggcagagga gttggaccga agggagcgag 421 agctgcagca tgctgccctg ggnggcacag ctactcgaca gaacaattgg ccccctctac 481 cttctttttg tccagttcag ccctgctttt tccaggacat ctccatggag atcccccaag 541 aatttcagaa gactgtatcc accatgtact acctctggat gtgcagcacg ctggctcttc 601 tcctgaactt cctcgcctgc ctggccagct tctgtgtgga aaccaacaat ggcgcaggct 661 ttgggctttc tatcctctgg gTCCTCCTTT TCACTCCCTG CTCCTTTGTC TGCTGGTACC 721 GCCCCATGTA TAAGGCTTTC CGGAGTGACA GTTCATTCAA TTTCTTCGTT TTCTTCTTCA 781 TTTTCTTCGT CCAGGATGTG CTCTTTGTCC TCCAGGCCAT TGGTATCCCA GGTTGGGGAT 841 TCAGTGGCTG GATCTCTGCT CTGGTGGTGC CGAAGGGCAA CACAGCAGTA TCCGTGCTCA 901 TGCTGCTGGT CGCCCTGCTC TTCACTGGCA TTGCTGTGCT AGGAATTGTC ATGCTGAAAC 961 GGATCCACTC CTTATACCGC CGCACAGGTG CCAGCTTTCA GAAGGCCCAG CAAGAATTTG 1021 CTGCTGGTGT CTTCTCCAAC CCTGCGGTGC GAACCGCAGC TGCCAATGCA GCCGCTGGGG 1081 CTGCTGAAAA TGCCTTCCGG GCCCCGTGCC CAACTTTCTT GTACAAAGTG GTTGATATCG 1141 GTAAGCCTAT CCCTAACCCT CTCCTCGGTC TCGATTCTAC GTAGTAATGA ACTAGTCCGT 1201 AACTTGAAAG TATTTCGATT TCTTGGCTTT ATATATCTTG TGGAAAGGAC GAACTCAACA 1261 AGTCCTCTCT CATGTTACGC GTTAAGTCga caatcaacct ctggattaca aaatttgtga 1321 aagatt