Transcript: Mouse NM_001309909.1

Mus musculus secretory carrier membrane protein 3 (Scamp3), transcript variant 1, mRNA.

Source:
NCBI, updated 2017-06-10
Taxon:
Mus musculus (mouse)
Gene:
Scamp3 (24045)
Length:
1579
CDS:
202..1254

Additional Resources:

NCBI RefSeq record:
NM_001309909.1
NBCI Gene record:
Scamp3 (24045)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001309909.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000105363 GCTTGACAATCCCTTTCAGGA pLKO.1 249 CDS 100% 2.640 3.696 N Scamp3 n/a
2 TRCN0000302621 GCTTGACAATCCCTTTCAGGA pLKO_005 249 CDS 100% 2.640 3.696 N Scamp3 n/a
3 TRCN0000105360 CCGCTGTGACTCAGTCATTAT pLKO.1 1422 3UTR 100% 13.200 6.600 Y Scamp3 n/a
4 TRCN0000302545 CCGCTGTGACTCAGTCATTAT pLKO_005 1422 3UTR 100% 13.200 6.600 Y Scamp3 n/a
5 TRCN0000105361 CCGGAGTGATAGTTCATTCAA pLKO.1 885 CDS 100% 5.625 2.813 Y Scamp3 n/a
6 TRCN0000302620 CCGGAGTGATAGTTCATTCAA pLKO_005 885 CDS 100% 5.625 2.813 Y Scamp3 n/a
7 TRCN0000105362 CCAAGACATCTCTATGGAGAT pLKO.1 657 CDS 100% 0.405 0.203 Y Scamp3 n/a
8 TRCN0000302607 CCAAGACATCTCTATGGAGAT pLKO_005 657 CDS 100% 0.405 0.203 Y Scamp3 n/a
9 TRCN0000105364 GCCCAGGAACTACGGCTCCTA pLKO.1 447 CDS 100% 0.000 0.000 Y Scamp3 n/a
10 TRCN0000302544 GCCCAGGAACTACGGCTCCTA pLKO_005 447 CDS 100% 0.000 0.000 Y Scamp3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001309909.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07543 pDONR223 100% 87.5% 89.7% None (many diffs) n/a
2 ccsbBroad304_07543 pLX_304 0% 87.5% 89.7% V5 (many diffs) n/a
3 TRCN0000466714 ACTCAACAAGTCCTCTCTCATGTT pLX_317 41% 87.5% 89.7% V5 (many diffs) n/a
4 ccsbBroadEn_10451 pDONR223 100% 87.3% 89.7% None (many diffs) n/a
5 ccsbBroad304_10451 pLX_304 0% 87.3% 89.7% V5 (many diffs) n/a
6 TRCN0000466842 CGATCATTTTTGAGTTCTCCTGTT pLX_317 28.9% 87.3% 89.7% V5 (many diffs) n/a
7 ccsbBroadEn_15692 pDONR223 0% 80.6% 83.1% None (many diffs) n/a
8 ccsbBroad304_15692 pLX_304 0% 80.6% 83.1% V5 (many diffs) n/a
Download CSV