Construct: ORF TRCN0000466784
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF003167.1_s317c1
- Derived from:
- ccsbBroadEn_04612
- DNA Barcode:
- AAAACCCAGGTCGTTCCAACTCAG
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- SFXN1 (94081)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000466784
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 94081 | SFXN1 | sideroflexin 1 | NM_001322977.2 | 100% | 100% | |
| 2 | human | 94081 | SFXN1 | sideroflexin 1 | NM_022754.7 | 100% | 100% | |
| 3 | human | 94081 | SFXN1 | sideroflexin 1 | NM_001322978.2 | 81% | 80.4% | 0_1ins154;4_5ins29 |
| 4 | human | 94081 | SFXN1 | sideroflexin 1 | NM_001322982.2 | 81% | 80.4% | 0_1ins154;4_5ins29 |
| 5 | human | 94081 | SFXN1 | sideroflexin 1 | NM_001322980.2 | 81% | 64.3% | 595_596ins128;783_784ins55 |
| 6 | human | 94081 | SFXN1 | sideroflexin 1 | NM_001322981.2 | 81% | 64.3% | 595_596ins128;783_784ins55 |
| 7 | human | 94081 | SFXN1 | sideroflexin 1 | NM_001322983.2 | 74.9% | 74.8% | 725_726delGTins242 |
| 8 | mouse | 14057 | Sfxn1 | sideroflexin 1 | NM_027324.5 | 84.5% | 94.7% | (many diffs) |
| 9 | mouse | 14057 | Sfxn1 | sideroflexin 1 | XM_006516849.3 | 84.5% | 94.7% | (many diffs) |
| 10 | mouse | 14057 | Sfxn1 | sideroflexin 1 | XM_006516850.3 | 84.5% | 94.7% | (many diffs) |
| 11 | mouse | 14057 | Sfxn1 | sideroflexin 1 | XM_011244373.2 | 69.5% | 76.7% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 1032
- ORF length:
- 966
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatgtc tggagaacta ccaccaaaca ttaacatcaa ggaacctcga tgggatcaaa 121 gcactttcat tggacgagcc aatcatttct tcactgtaac tgaccccagg aacattctgt 181 taaccaacga acaactcgag agtgcgagaa aaatagtaca tgattacagg caaggaattg 241 ttcctcctgg tcttacagaa aatgaattgt ggagagcaaa gtacatctat gattcagctt 301 ttcatcctga cactggtgag aagatgattt tgataggaag aatgtcagcc caggttccca 361 tgaacatgac catcacaggt tgtatgatga cgttttacag gactacgccg gctgtgctgt 421 tctggcagtg gattaaccag tccttcaatg ccgtcgtcaa ttacaccaac agaagtggag 481 acgcacccct cactgtcaat gagttgggaa cagcttacgt ttctgcaaca actggtgccg 541 tagcaacagc tctaggactc aatgcattga ccaagcatgt ctcaccactg ataggacgtt 601 ttgttccctt tgctgccGTA GCTGCTGCTA ATTGCATTAA TATTCCATTA ATGAGGCAAA 661 GGGAACTCAA AGTTGGCATT CCCGTCACGG ATGAGAATGG GAACCGCTTG GGGGAGTCGG 721 CGAACGCTGC GAAACAAGCC ATCACGCAAG TTGTCGTGTC CAGGATTCTC ATGGCAGCCC 781 CTGGCATGGC CATCCCTCCA TTCATTATGA ACACTTTGGA AAAGAAAGCC TTTTTGAAGA 841 GGTTCCCATG GATGAGTGCA CCCATTCAAG TTGGGTTAGT TGGCTTCTGT TTGGTGTTTG 901 CTACACCCCT GTGTTGTGCC CTGTTTCCTC AGAAAAGTTC CATGTCTGTG ACAAGCTTGG 961 AGGCCGAGTT GCAAGCTAAG ATCCAAGAGA GCCATCCTGA ATTGCGACGC GTGTACTTCA 1021 ATAAGGGATT GTACCCAACT TTCTTGTACA AAGTGGTTGA TATCGGTAAG CCTATCCCTA 1081 ACCCTCTCCT CGGTCTCGAT TCTACGTAGT AATGAACTAG TCCGTAACTT GGAAAGTATT 1141 TCGATTTCTT GGCTTTATAT ATCTTGTGGA AAGGACGAAA AACCCAGGTC GTTCCAACTC 1201 AGACGCGTTA AGTCgacaat caacctctgg attacaaaat ttgtgaaaga tt