Transcript: Human NM_001322982.2

Homo sapiens sideroflexin 1 (SFXN1), transcript variant 6, mRNA.

Source:
NCBI, updated 2019-09-28
Taxon:
Homo sapiens (human)
Gene:
SFXN1 (94081)
Length:
4065
CDS:
272..1057

Additional Resources:

NCBI RefSeq record:
NM_001322982.2
NBCI Gene record:
SFXN1 (94081)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001322982.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000296550 AGCTCTGGGCTAATCTATAAA pLKO_005 1507 3UTR 100% 15.000 21.000 N SFXN1 n/a
2 TRCN0000060282 CATGACCATCACAGGTTGTAT pLKO.1 388 CDS 100% 5.625 7.875 N SFXN1 n/a
3 TRCN0000290347 CATGACCATCACAGGTTGTAT pLKO_005 388 CDS 100% 5.625 7.875 N SFXN1 n/a
4 TRCN0000060278 GCACCCATTCAAGTTGGGTTA pLKO.1 881 CDS 100% 0.405 0.567 N SFXN1 n/a
5 TRCN0000060279 GCTGCTGCTAATTGCATTAAT pLKO.1 644 CDS 100% 15.000 10.500 N SFXN1 n/a
6 TRCN0000290346 GCTGCTGCTAATTGCATTAAT pLKO_005 644 CDS 100% 15.000 10.500 N SFXN1 n/a
7 TRCN0000296551 CCTTCAATGCCGTCGTCAATT pLKO_005 465 CDS 100% 13.200 9.240 N SFXN1 n/a
8 TRCN0000296549 CTGTTCTGGCAGTGGATTAAC pLKO_005 440 CDS 100% 13.200 9.240 N SFXN1 n/a
9 TRCN0000060280 CGTGTACTTCAATAAGGGATT pLKO.1 1033 CDS 100% 4.050 2.835 N SFXN1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001322982.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_13003 pDONR223 100% 90.4% 90.4% None 1_75del n/a
2 ccsbBroad304_13003 pLX_304 0% 90.4% 90.4% V5 1_75del n/a
3 TRCN0000468013 GACAAGAAGATGACTTCTGCTATT pLX_317 69% 90.4% 90.4% V5 1_75del n/a
4 ccsbBroadEn_04612 pDONR223 100% 81% 80.4% None 0_1ins154;4_5ins29 n/a
5 ccsbBroad304_04612 pLX_304 0% 81% 80.4% V5 0_1ins154;4_5ins29 n/a
6 TRCN0000466784 AAAACCCAGGTCGTTCCAACTCAG pLX_317 43.1% 81% 80.4% V5 0_1ins154;4_5ins29 n/a
Download CSV