Construct: ORF TRCN0000466882
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF016454.1_s317c1
- Derived from:
- ccsbBroadEn_04422
- DNA Barcode:
- TGTTTTCCATCGATGCATCTGTTC
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- CRACR2A (84766)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000466882
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- n/a
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 84766 | CRACR2A | calcium release activated c... | NM_032680.4 | 100% | 100% | |
| 2 | human | 84766 | CRACR2A | calcium release activated c... | NM_001144958.2 | 53.2% | 50.7% | (many diffs) |
| 3 | human | 84766 | CRACR2A | calcium release activated c... | XM_006719021.3 | 53.2% | 50.6% | (many diffs) |
| 4 | human | 84766 | CRACR2A | calcium release activated c... | XM_011521034.3 | 53.2% | 50.6% | (many diffs) |
| 5 | human | 84766 | CRACR2A | calcium release activated c... | XM_011521036.3 | 53.2% | 50.6% | (many diffs) |
| 6 | human | 84766 | CRACR2A | calcium release activated c... | XM_011521037.2 | 20.5% | 18.4% | (many diffs) |
| 7 | human | 84766 | CRACR2A | calcium release activated c... | XM_011521038.2 | 20.5% | 18.4% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 1251
- ORF length:
- 1185
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatggc tgcccctgac gggagggtag tctccagacc ccagagactt ggtcaggggt 121 ctggccaggg gccaaagggg agtggagcct gcctgcatcc cctggacagc ctggagcaga 181 aggagactca ggagcaaacg tcgggccagc tagtcatgct gaggaaggca caggagttct 241 ttcagacctg tgatgctgaa ggcaagggct tcatcgccag gaaggatatg cagaggctgc 301 ataaggagct accgctcagc ctggaggaac tggaggatgt gtttgatgcc ctggatgctg 361 atggcaatgg ctatctgacc ccacaggagt tcactactgg atttagtcac ttcttcttca 421 gccagaataa cccaagtcag gaagatgcag gtgaacaggt ggcccagcgc catgaagaga 481 aggtgtatct gtccagaggg gatgaggatc tgggcgacat gggcgaagat gaggaagccc 541 agttccggat gctgatggac agacttggag cccaaaaggt gttggaagat gaaagtgatg 601 tcaagcagct ctggttgcag ctgaagaagg aggaacctca tttactgtcc aactttgaag 661 acttcctgac cagaatcatc tcccagctcc aagaagccca tgaggagaag aatgaactgg 721 agtgtgccct aaaaaggaaa attgctgctt atgatgaaga aatccagcat ctctatgagg 781 agatggaaca acaaatcaaa agtgagaagg agcagtttct ccTGAAGGAC ACAGAGAGGT 841 TTCAAGCCCG CAGTCAAGAG CTGGAGCAGA AACTGTTATG TAAGGAGCAG GAGCTGGAGC 901 AGCTCACCCA GAAGCAGAAA AGGCTGGAAG GTCAGTGCAC AGCCCTGCAT CATGACAAGC 961 ATGAGACCAA GGCTGAGAAT ACCAAGCTGA AACTCACTAA CCAGGAGCTG GCCCGGGAGC 1021 TGGAGCGGAC TTCCTGGGAG CTCCAGGATG CTCAGCAGCA GTTGGAAAGC CTCCAGCAAG 1081 AGGCCTGCAA ACTCCACCAA GAGAAGGAGA TGGAAGTGTA CCGTGTGACG GAGAGTCTAC 1141 AGCGTGAGAA GGCCGGGCTC CTCAAGCAGC TGGATTTCCT AAGGTGCGTC GGTGGGCACT 1201 GGCCTGTGCT GAGAGCACCT CCCAGAAGCC TGGGGTCGGA AGGACCAGTC TGCCCAACTT 1261 TCTTGTACAA AGTGGTTGAT ATCGGTAAGC CTATCCCTAA CCCTCTCCTC GGTCTCGATT 1321 CTACGTAGTA ATGAACTAGT CCGTAACTTG AAAGTATTTC GATTTCTTGG CTTTATATAT 1381 CTTGTGGAAA GGACGATGTT TTCCATCGAT GCATCTGTTC ACGCGTTAAG TCgacaatca 1441 acctctggat tacaaaattt gtgaaagatt