Transcript: Human XM_011521036.3

PREDICTED: Homo sapiens calcium release activated channel regulator 2A (CRACR2A), transcript variant X3, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
CRACR2A (84766)
Length:
4269
CDS:
82..2280

Additional Resources:

NCBI RefSeq record:
XM_011521036.3
NBCI Gene record:
CRACR2A (84766)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011521036.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000416828 TGAACTGGAGTGTGCCCTAAA pLKO_005 729 CDS 100% 10.800 8.640 N CRACR2A n/a
2 TRCN0000424782 AGAAGGAGGAACCTCATTTAC pLKO_005 641 CDS 100% 13.200 9.240 N CRACR2A n/a
3 TRCN0000053331 AGAAGGAGACTCAGGAGCAAA pLKO.1 194 CDS 100% 4.950 3.465 N CRACR2A n/a
4 TRCN0000053332 CACTACTGGATTTAGTCACTT pLKO.1 408 CDS 100% 4.950 3.465 N CRACR2A n/a
5 TRCN0000053328 CGCCATGAAGAGAAGGTGTAT pLKO.1 484 CDS 100% 4.950 3.465 N CRACR2A n/a
6 TRCN0000053329 GCTGAGAATACCAAGCTGAAA pLKO.1 988 CDS 100% 4.950 3.465 N CRACR2A n/a
7 TRCN0000053330 GTGTTGGAAGATGAAAGTGAT pLKO.1 595 CDS 100% 4.950 3.465 N CRACR2A n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011521036.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_04422 pDONR223 100% 53.2% 50.6% None (many diffs) n/a
2 ccsbBroad304_04422 pLX_304 0% 53.2% 50.6% V5 (many diffs) n/a
3 TRCN0000466882 TGTTTTCCATCGATGCATCTGTTC pLX_317 36.4% 53.2% 50.6% V5 (many diffs) n/a
Download CSV