Construct: ORF TRCN0000466961
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF004825.1_s317c1
- Derived from:
- ccsbBroadEn_14447
- DNA Barcode:
- TGTTCACCGCTGGTTGAATTGGAA
- Epitope Tag:
- V5 (not translated due to frame shift)
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- TECRL (253017)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000466961
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- n/a
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 253017 | TECRL | trans-2,3-enoyl-CoA reducta... | XM_017007959.2 | 82.3% | 81.4% | (many diffs) |
| 2 | human | 253017 | TECRL | trans-2,3-enoyl-CoA reducta... | XM_005265665.4 | 78% | 77.2% | (many diffs) |
| 3 | human | 253017 | TECRL | trans-2,3-enoyl-CoA reducta... | XM_005265664.3 | 76.6% | 75.7% | (many diffs) |
| 4 | human | 253017 | TECRL | trans-2,3-enoyl-CoA reducta... | NM_001363796.1 | 74.7% | 73.9% | (many diffs) |
| 5 | human | 253017 | TECRL | trans-2,3-enoyl-CoA reducta... | XM_024453962.1 | 73.2% | 72.4% | (many diffs) |
| 6 | human | 253017 | TECRL | trans-2,3-enoyl-CoA reducta... | XM_024453961.1 | 70.1% | 69.3% | (many diffs) |
| 7 | human | 253017 | TECRL | trans-2,3-enoyl-CoA reducta... | NM_001010874.5 | 67.1% | 66.3% | (many diffs) |
| 8 | human | 253017 | TECRL | trans-2,3-enoyl-CoA reducta... | XR_001741192.2 | 66% | (many diffs) | |
| 9 | human | 253017 | TECRL | trans-2,3-enoyl-CoA reducta... | XM_005265662.5 | 62.9% | 62.2% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 801
- ORF length:
- 735
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatgtt caaaaggcac aagtccctcg cttcggaacg caagagagca ttactttccc 121 aaagagctac acggttcata ctgaaggatg atatgagaaa ttttcacttt ttgtcaaaac 181 ttgtactctc agcgggccct ctaagaccaa ctccagcagt caaacattca aagacgactc 241 actttgagat tgaaatattt gatgctcaaa caaggaaaca gatatgtatt ctggataagg 301 tgacacaatc atctactatt catgatgtta agcaaaagtt tcacaaagca tgtccaaagt 361 ggtacccttc tcgagttggt ctgcagctag aatgtggcgg gccttttttg aaggactaca 421 ttaccattca aagtattgca gcttcctcca ttgtcacact gtatgctaca gaccTAGGTC 481 AACAAGTCAG TTGGACCACA GTGTTTTTGG CTGAATACAC AGGACCTCTG CTAATATACC 541 TCCTCTTTTA TTTGAGGATC CCATGTATAT ATGATGGAAA AGAGAGTGCT AGAAGATTAC 601 GCCACCCAGT GGTACACTTG GCTTGCTTCT GTCATTGTAT ACACTACATC CGATACCTTT 661 TGGAAACCTT ATTTGTTCAC AAAGTTTCTG CAGGACACAC ACCTTTGAAA AATTTGATAA 721 TGAGTTGTGC CTTTTACTGG GGATTTACTT CTTGGATTGC CTACTACATT AATCATCCAC 781 TATATACACA CCATGTATGT ACCCAACTTT CTTGTACAAA GTGGTTGATA TCGGTAAGCC 841 TATCCCTAAC CCTCTCCTCG GTCTCGATTC TACGTAGTAA TGAACTAGTC CGTAACTTGA 901 AAGTATTTCG ATTTCTTGGC TTTATATATC TTGTGGAAAG GACGATGTTC ACCGCTGGTT 961 GAATTGGAAA CGCGTTAAGT Cgacaatcaa cctctggatt acaaaatttg tgaaagatt