Transcript: Human XM_024453961.1

PREDICTED: Homo sapiens trans-2,3-enoyl-CoA reductase like (TECRL), transcript variant X5, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
TECRL (253017)
Length:
1832
CDS:
160..1095

Additional Resources:

NCBI RefSeq record:
XM_024453961.1
NBCI Gene record:
TECRL (253017)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_024453961.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000158841 GATTGGATCATGGATTAGTTT pLKO.1 1032 CDS 100% 5.625 3.938 N TECRL n/a
2 TRCN0000163528 GCAGGACACACACCTTTGAAA pLKO.1 739 CDS 100% 5.625 3.938 N TECRL n/a
3 TRCN0000160461 CCATTCAAAGTATTGCAGCTT pLKO.1 473 CDS 100% 2.640 1.848 N TECRL n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_024453961.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_14447 pDONR223 100% 70.1% 69.3% None (many diffs) n/a
2 ccsbBroad304_14447 pLX_304 0% 70.1% 69.3% V5 (not translated due to frame shift) (many diffs) n/a
3 TRCN0000466961 TGTTCACCGCTGGTTGAATTGGAA pLX_317 44.5% 70.1% 69.3% V5 (not translated due to frame shift) (many diffs) n/a
Download CSV