Construct: ORF TRCN0000466994
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF003397.1_s317c1
- Derived from:
- ccsbBroadEn_04759
- DNA Barcode:
- GGAGCTTACAACCGCTGACGTTAG
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- SLAIN1 (122060)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000466994
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 122060 | SLAIN1 | SLAIN motif family member 1 | NM_001366666.1 | 100% | 100% | |
| 2 | human | 122060 | SLAIN1 | SLAIN motif family member 1 | NM_144595.4 | 100% | 100% | |
| 3 | human | 122060 | SLAIN1 | SLAIN motif family member 1 | NM_001242871.1 | 94.8% | 92.6% | (many diffs) |
| 4 | human | 122060 | SLAIN1 | SLAIN motif family member 1 | NM_001040153.3 | 71.5% | 71.5% | 1_363del |
| 5 | human | 122060 | SLAIN1 | SLAIN motif family member 1 | NM_001366665.1 | 64% | 64% | 1_513del |
| 6 | human | 122060 | SLAIN1 | SLAIN motif family member 1 | NM_001242869.1 | 62.6% | 62.2% | 61_62ins342 |
| 7 | human | 122060 | SLAIN1 | SLAIN motif family member 1 | NM_001242870.2 | 62.6% | 62.2% | 61_62ins342 |
| 8 | human | 122060 | SLAIN1 | SLAIN motif family member 1 | NM_001242868.2 | 51.6% | 51.6% | 1_855del |
| 9 | human | 122060 | SLAIN1 | SLAIN motif family member 1 | XR_002957451.1 | 16.8% | (many diffs) | |
| 10 | mouse | 105439 | Slain1 | SLAIN motif family, member 1 | NM_198014.2 | 44.7% | 48.8% | (many diffs) |
| 11 | mouse | 105439 | Slain1 | SLAIN motif family, member 1 | XM_006518339.3 | 41.2% | 44.9% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 981
- ORF length:
- 915
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatggg atataaatta caggacctca ctgatgttca gatcatggct cgtctgcaag 121 aagaaagtct caggcaagat tatgcttcta cttcagcatc tgtatcaaga catagttcca 181 gtgtgtcatt gagttcagga aaaaaaggga catgtagtga tcaagaatat gaccaataca 241 gtctggagga tgaagaggaa tttgatcatt tgccaccacc tcagcctcgt cttccaagat 301 gttccccttt ccaaagagga attccccatt cacagacttt ctccagcatt cgggagtgta 361 ggaggagccc cagttcccag tattttcctt caaataatta ccagcagcaa cagtattatt 421 cacctcaagc ccaaactcca gatcagcaac caaataggac caatggagat aagctccgaa 481 gaagtatgcc taacctagcc cggatgccaa gtacaactgc cattagtagc aacattagtt 541 ctccggtcac cgtgcgaaat agtcagagtt ttgactcaag cttgcatgga gctggaaatg 601 gaatttcaag aatacaatct tgtattccaT CACCGGGACA GCTTCAACAC AGGGTCCACA 661 GCGTGGGGCA TTTCCCAGTG TCTATCCGAC AGCCTCTTAA AGCCACAGCC TATGTGAGTC 721 CAACCGTTCA AGGCAGCAGT AACATGCCTT TATCAAACGG CTTACAGCTG TATTCCAACA 781 CAGGAATCCC CACACCGAAC AAAGCTGCAG CTTCTGGGAT AATGGGTCGC AGTGCACTCC 841 CAAGACCTTC GTTGGCAATA AATGGGAGTA ACCTGCCTCG AAGCAAAATT GCACAACCTG 901 TTAGAAGTTT TCTTCAGCCT CCAAAGCCTC TGTCTTCACT CAGCACTCTG AGGGATGGAA 961 ATTGGAGAGA TGGTTGCTAC TACCCAACTT TCTTGTACAA AGTGGTTGAT ATCGGTAAGC 1021 CTATCCCTAA CCCTCTCCTC GGTCTCGATT CTACGTAGTA ATGAACTAGT CCGTAACTTG 1081 AAAGTATTTC GATTTCTTGG CTTTATATAT CTTGTGGAAA GGACGAGGAG CTTACAACCG 1141 CTGACGTTAG ACGCGTTAAG TCgacaatca acctctggat tacaaaattt gtgaaagatt