Transcript: Human NM_001242870.2

Homo sapiens SLAIN motif family member 1 (SLAIN1), transcript variant 5, mRNA.

Source:
NCBI, updated 2019-05-31
Taxon:
Homo sapiens (human)
Gene:
SLAIN1 (122060)
Length:
1896
CDS:
312..887

Additional Resources:

NCBI RefSeq record:
NM_001242870.2
NBCI Gene record:
SLAIN1 (122060)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001242870.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000243061 CAAACGGCTTACAGCTGTATT pLKO_005 658 CDS 100% 13.200 18.480 N SLAIN1 n/a
2 TRCN0000243059 TCTATCCGACAGCCTCTTAAA pLKO_005 585 CDS 100% 13.200 18.480 N SLAIN1 n/a
3 TRCN0000243060 CCAGTCACCAGAGACTAATTA pLKO_005 1028 3UTR 100% 15.000 10.500 N SLAIN1 n/a
4 TRCN0000243058 CAAGACCTTCGTTGGCAATAA pLKO_005 745 CDS 100% 13.200 9.240 N SLAIN1 n/a
5 TRCN0000167771 GCACTAATGAATGCTTTCTTA pLKO.1 1799 3UTR 100% 5.625 3.938 N SLAIN1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001242870.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_04759 pDONR223 100% 62.6% 62.2% None 61_62ins342 n/a
2 ccsbBroad304_04759 pLX_304 0% 62.6% 62.2% V5 61_62ins342 n/a
3 TRCN0000466994 GGAGCTTACAACCGCTGACGTTAG pLX_317 38.7% 62.6% 62.2% V5 61_62ins342 n/a
Download CSV