Construct: ORF TRCN0000467080
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF006863.1_s317c1
- Derived from:
- ccsbBroadEn_04951
- DNA Barcode:
- TGCGAGCAGGACAGGTGCAATGTA
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- NANP (140838)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000467080
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- n/a
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 140838 | NANP | N-acetylneuraminic acid pho... | NM_152667.3 | 100% | 100% | |
| 2 | mouse | 67311 | Nanp | N-acetylneuraminic acid pho... | NM_026086.2 | 86% | 93.9% | (many diffs) |
| 3 | mouse | 67311 | Nanp | N-acetylneuraminic acid pho... | XM_006500068.3 | 77.5% | 83.2% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 810
- ORF length:
- 744
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatggg gctgagccgc gtgcgggcgg ttttctttga cttggacaac actctcatcg 121 acacggccgg ggcgagcagg agaggcatgt tggaggtgat aaaactctta caatcaaaat 181 accattataa agaagaggct gaaatcatct gtgataaagt tcaagttaaa ctcagcaagg 241 aatgttttca tccttacaat acatgcatta ctgatttaag gacttcacat tgggaagaag 301 caatccagga aacaaaaggt ggtgcagcca atagaaaatt ggctgaagaa tgttatttcc 361 tttggaaatc tacacgttta cagcatatga cactagcaga agacgtcaaa gccatgctta 421 ctgaacttcg aaaggaggTC CGCCTACTTC TATTAACGAA TGGGGACAGA CAGACCCAGA 481 GGGAGAAGAT TGAGGCTTGT GCCTGTCAGT CCTATTTTGA CGCTGTTGTT GTAGGTGGAG 541 AGCAGAGAGA GGAGAAACCA GCACCGTCCA TATTTTATTA CTGCTGCAAT CTTCTCGGAG 601 TACAACCTGG GGACTGTGTG ATGGTCGGTG ACACATTAGA AACCGACATC CAAGGAGGCC 661 TCAATGCAGG ATTGAAAGCA ACAGTCTGGA TCAATAAAAA TGGAATAGTG CCACTGAAGT 721 CCTCCCCAGT TCCGCATTAC ATGGTTTCTT CTGTGCTAGA GTTACCTGCT CTCTTACAAA 781 GTATAGACTG CAAAGTCAGT ATGTCCACTT ACCCAACTTT CTTGTACAAA GTGGTTGATA 841 TCGGTAAGCC TATCCCTAAC CCTCTCCTCG GTCTCGATTC TACGTAGTAA TGAACTAGTC 901 CGTAACTTGA AAGTATTTCG ATTTCTTGGC TTTATATATC TTGTGGAAAG GACGATGCGA 961 GCAGGACAGG TGCAATGTAA CGCGTTAAGT Cgacaatcaa cctctggatt acaaaatttg 1021 tgaaagatt