Transcript: Human NM_152667.3

Homo sapiens N-acetylneuraminic acid phosphatase (NANP), mRNA.

Source:
NCBI, updated 2019-05-02
Taxon:
Homo sapiens (human)
Gene:
NANP (140838)
Length:
3803
CDS:
67..813

Additional Resources:

NCBI RefSeq record:
NM_152667.3
NBCI Gene record:
NANP (140838)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_152667.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000050488 CGCCTACTTCTATTAACGAAT pLKO.1 442 CDS 100% 4.950 6.930 N NANP n/a
2 TRCN0000050491 GCAAAGTCAGTATGTCCACTT pLKO.1 791 CDS 100% 4.050 3.240 N NANP n/a
3 TRCN0000430845 ACATGCAAATCAAGGTATTAT pLKO_005 1290 3UTR 100% 15.000 10.500 N NANP n/a
4 TRCN0000050489 CCTGCTCTCTTACAAAGTATA pLKO.1 766 CDS 100% 13.200 9.240 N NANP n/a
5 TRCN0000417954 AGTTAGGGCACTCCACTTATG pLKO_005 875 3UTR 100% 10.800 7.560 N NANP n/a
6 TRCN0000419429 CACTAGCAGAAGACGTCAAAG pLKO_005 392 CDS 100% 10.800 7.560 N NANP n/a
7 TRCN0000050490 CCTTTGGAAATCTACACGTTT pLKO.1 360 CDS 100% 4.950 3.465 N NANP n/a
8 TRCN0000050492 GCATTACTGATTTAAGGACTT pLKO.1 266 CDS 100% 4.050 2.835 N NANP n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_152667.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_04951 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_04951 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000467080 TGCGAGCAGGACAGGTGCAATGTA pLX_317 50% 100% 100% V5 n/a
Download CSV