Construct: ORF TRCN0000467212
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF009953.1_s317c1
- Derived from:
- ccsbBroadEn_11636
- DNA Barcode:
- TTTCATTTTTATTCTGCGATCTAT
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- CILK1 (22858)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000467212
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 22858 | CILK1 | ciliogenesis associated kin... | NM_014920.4 | 45.1% | 44.7% | (many diffs) |
| 2 | human | 22858 | CILK1 | ciliogenesis associated kin... | NM_016513.4 | 45.1% | 44.7% | (many diffs) |
| 3 | human | 22858 | CILK1 | ciliogenesis associated kin... | XM_017010488.1 | 45.1% | 44.7% | (many diffs) |
| 4 | human | 22858 | CILK1 | ciliogenesis associated kin... | XM_017010489.1 | 45.1% | 44.7% | (many diffs) |
| 5 | human | 22858 | CILK1 | ciliogenesis associated kin... | XM_017010490.1 | 45.1% | 44.7% | (many diffs) |
| 6 | human | 22858 | CILK1 | ciliogenesis associated kin... | XM_017010491.1 | 45.1% | 44.7% | (many diffs) |
| 7 | human | 22858 | CILK1 | ciliogenesis associated kin... | XM_017010492.1 | 45.1% | 44.7% | (many diffs) |
| 8 | human | 22858 | CILK1 | ciliogenesis associated kin... | XM_011514419.1 | 44.6% | 44.2% | (many diffs) |
| 9 | human | 22858 | CILK1 | ciliogenesis associated kin... | XM_011514420.2 | 44.6% | 44.2% | (many diffs) |
| 10 | human | 22858 | CILK1 | ciliogenesis associated kin... | XM_011514421.1 | 44.6% | 44.2% | (many diffs) |
| 11 | human | 22858 | CILK1 | ciliogenesis associated kin... | XM_017010485.1 | 44.6% | 44.2% | (many diffs) |
| 12 | human | 22858 | CILK1 | ciliogenesis associated kin... | XM_017010486.1 | 44.6% | 44.2% | (many diffs) |
| 13 | human | 22858 | CILK1 | ciliogenesis associated kin... | XM_017010487.1 | 44.6% | 44.2% | (many diffs) |
| 14 | mouse | 56542 | Ick | intestinal cell kinase | NM_001163780.1 | 40.5% | 43.2% | (many diffs) |
| 15 | mouse | 56542 | Ick | intestinal cell kinase | NM_019987.2 | 40.5% | 43.2% | (many diffs) |
| 16 | mouse | 56542 | Ick | intestinal cell kinase | XM_006511304.2 | 40.5% | 43.2% | (many diffs) |
| 17 | mouse | 56542 | Ick | intestinal cell kinase | XM_006511305.3 | 29% | 30.6% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 942
- ORF length:
- 876
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatgaa tagatacaca acaatcaggc agctcgggga tggaacctac ggttccgtcc 121 tgctgggaag aagcattgag tctggggagc tgatcgctat taaaaaaatg aaaagaaaat 181 tttattcctg ggaggaatgc atgaaccttc gggaggttaa gtctttaaag aagctcaacc 241 atgccaatgt agtcaaatta aaagaagtta tcagggaaaa tgatcatctt tattttatct 301 tcgagtacat gaaggaaaat ctttaccagc tcattaaaga gagaaataag ttgtttcctg 361 agtctgctat aaggaatatc atgtatcaga tattacaagg actcgcattt attcacaaac 421 acggcttctt tcatcgagac ttaaagcctg agaacctcct ctgcatggGA CCAGAACTTG 481 TGAAAATTGC AGACTTTGGT TTGGCCCGAG AAATACGATC AAAACCTCCA TATACAGATT 541 ATGTATCTAC CAGATGGTAC AGGGCTCCAG AAGTACTCCT GAGGTCTACC AACTACAGCT 601 CCCCCATTGA CGTCTGGGCG GTGGGCTGCA TCATGGCAGA AGTTTACACC CTCAGGCCAC 661 TCTTCCCTGG AGCCAGTGAA ATTGACACAA TATTCAAAAT TTGCCAAGTG CTGGGGACAC 721 CAAAAAAGAC TGACTGGCCT GAAGGCTATC AACTTTCAAG TGCAATGAAC TTCCGTTGGC 781 CACAGTGTGT ACCCAATAAC TTAAAGACCT TGATTCCCAA TGCTAGCAGT GAAGCAGTCC 841 AGCTCCTGAG AGACATGCTT CAGTGGGATC CCAAGAAACG ACCAACAGCT AGTCAGGTTT 901 TCTTCCATTT TCTTGTTATA ACGTTCATAT CTAACTCTGA ATACCCAACT TTCTTGTACA 961 AAGTGGTTGA TATCGGTAAG CCTATCCCTA ACCCTCTCCT CGGTCTCGAT TCTACGTAGT 1021 AATGAACTAG TCCGTAACTT GAAAGTATTT CGATTTCTTG GCTTTATATA TCTTGTGGAA 1081 AGGACGATTT CATTTTTATT CTGCGATCTA TACGCGTTAA GTCgacaatc aacctctgga 1141 ttacaaaatt tgtgaaagat t