Transcript: Mouse XM_006511305.3

PREDICTED: Mus musculus intestinal cell kinase (Ick), transcript variant X2, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Ick (56542)
Length:
6159
CDS:
153..1799

Additional Resources:

NCBI RefSeq record:
XM_006511305.3
NBCI Gene record:
Ick (56542)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006511305.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000353179 TAATCATGCCAATATCGTAAA pLKO_005 80 5UTR 100% 10.800 15.120 N Ick n/a
2 TRCN0000025959 GCCAAGGCATATACGCTGATT pLKO.1 879 CDS 100% 4.950 6.930 N Ick n/a
3 TRCN0000322183 GCCAAGGCATATACGCTGATT pLKO_005 879 CDS 100% 4.950 6.930 N Ick n/a
4 TRCN0000025904 CACAACCACGAGGCGGTGTAA pLKO.1 1847 3UTR 100% 1.650 2.310 N Ick n/a
5 TRCN0000322184 CACAACCACGAGGCGGTGTAA pLKO_005 1847 3UTR 100% 1.650 2.310 N Ick n/a
6 TRCN0000322186 GGAATATAATGTACCAGATAT pLKO_005 217 CDS 100% 13.200 10.560 N Ick n/a
7 TRCN0000350676 GCTAGTCAGGCTCTTCGATAT pLKO_005 732 CDS 100% 10.800 8.640 N Ick n/a
8 TRCN0000025955 CCAGCTCATTAAAGAAAGAAA pLKO.1 170 CDS 100% 5.625 3.938 N Ick n/a
9 TRCN0000025928 CCCAATAACTTAAAGACTCTA pLKO.1 636 CDS 100% 4.950 3.465 N Ick n/a
10 TRCN0000025945 CCAGTGAAATTGACACAATTT pLKO.1 517 CDS 100% 1.320 0.924 N Ick n/a
11 TRCN0000006324 CCAGTGAAATTGACACAATAT pLKO.1 517 CDS 100% 13.200 9.240 N CILK1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006511305.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_11636 pDONR223 100% 29% 30.6% None (many diffs) n/a
2 ccsbBroad304_11636 pLX_304 0% 29% 30.6% V5 (many diffs) n/a
3 TRCN0000467212 TTTCATTTTTATTCTGCGATCTAT pLX_317 54% 29% 30.6% V5 (many diffs) n/a
Download CSV