Construct: ORF TRCN0000467217
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF001968.1_s317c1
- Derived from:
- ccsbBroadEn_04895
- DNA Barcode:
- ATGGTAGCGTTTTAACGACATATG
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- C5orf24 (134553)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000467217
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- n/a
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 134553 | C5orf24 | chromosome 5 open reading f... | NM_001135586.1 | 100% | 100% | |
| 2 | human | 134553 | C5orf24 | chromosome 5 open reading f... | NM_152409.3 | 100% | 100% | |
| 3 | human | 134553 | C5orf24 | chromosome 5 open reading f... | XM_005271889.3 | 100% | 100% | |
| 4 | human | 134553 | C5orf24 | chromosome 5 open reading f... | XM_017009049.1 | 100% | 100% | |
| 5 | human | 134553 | C5orf24 | chromosome 5 open reading f... | XM_017009050.1 | 100% | 100% | |
| 6 | human | 134553 | C5orf24 | chromosome 5 open reading f... | NM_001300894.2 | 77.8% | 77.6% | (many diffs) |
| 7 | mouse | 78521 | B230219D22Rik | RIKEN cDNA B230219D22 gene | NM_181278.2 | 91.4% | 93.6% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 630
- ORF length:
- 564
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatgat gcatcctgtt gccagcagta atccagcttt ctgtgggcct ggcaagcctt 121 cctgcctcaa tgaagatgcc atgagagctg ctgatcagtt tgacatatat tcctcccagc 181 aaagcaaata cagccacaca gtcaaccaca aaccaatggt ttgtcagagg caagacccat 241 taaatgaaac acacttgcag actacaagtg gcagaagcat agaaataaaa gatgaactaa 301 agaaaaagaa gaatctcaac cgatctggta agcgtggccg gccttcggga accaccaaat 361 cagcaggata ccggaccagc acaggcagac ccctgggaac caccaaagca gctggattta 421 agacaagtCC AGGCAGACCT TTGGGGACAA CTAAAGCTGC GGGATACAAA GTCAGCCCAG 481 GCAGACCTCC AGGTAGCATT AAAGCTCTAT CCCGTCTTGC CGATCTTGGT TATGGCTGTG 541 GCACTGCTGC TTTTCCTTAC CCTATGATGC ATGGCAGAGC AGTTCATGGG GTAGAGGAAA 601 CTAGCAGTGA AGTCAAACCA CCCAATGAGT GCCCAACTTT CTTGTACAAA GTGGTTGATA 661 TCGGTAAGCC TATCCCTAAC CCTCTCCTCG GTCTCGATTC TACGTAGTAA TGAACTAGTC 721 CGTAACTTGA AAGTATTTCG ATTTCTTGGC TTTATATATC TTGTGGAAAG GACGAATGGT 781 AGCGTTTTAA CGACATATGA CGCGTTAAGT Cgacaatcaa cctctggatt acaaaatttg 841 tgaaagatt