Transcript: Human NM_001135586.1

Homo sapiens chromosome 5 open reading frame 24 (C5orf24), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-05-04
Taxon:
Homo sapiens (human)
Gene:
C5orf24 (134553)
Length:
5083
CDS:
249..815

Additional Resources:

NCBI RefSeq record:
NM_001135586.1
NBCI Gene record:
C5orf24 (134553)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001135586.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000426933 ACCATTATACCTATTAGTTTG pLKO_005 1145 3UTR 100% 10.800 15.120 N C5orf24 n/a
2 TRCN0000141473 CGTCTTGCCGATCTTGGTTAT pLKO.1 696 CDS 100% 10.800 15.120 N C5orf24 n/a
3 TRCN0000414569 CTAAAGCTGCGGGATACAAAG pLKO_005 634 CDS 100% 10.800 15.120 N C5orf24 n/a
4 TRCN0000122184 GCTGATCAGTTTGACATATAT pLKO.1 333 CDS 100% 15.000 10.500 N C5orf24 n/a
5 TRCN0000142503 GTCAGAGGCAAGACCCATTAA pLKO.1 406 CDS 100% 13.200 9.240 N C5orf24 n/a
6 TRCN0000413285 TCATGTTTCATTACTACTTTG pLKO_005 1083 3UTR 100% 10.800 7.560 N C5orf24 n/a
7 TRCN0000144837 GCTGAAGAGAAAGACATCTAA pLKO.1 3639 3UTR 100% 5.625 3.938 N C5orf24 n/a
8 TRCN0000144502 CAGGTAGCATTAAAGCTCTAT pLKO.1 673 CDS 100% 4.950 3.465 N C5orf24 n/a
9 TRCN0000143357 GAATCTCAACCGATCTGGTAA pLKO.1 494 CDS 100% 4.950 3.465 N C5orf24 n/a
10 TRCN0000143158 CCAGGTAGCATTAAAGCTCTA pLKO.1 672 CDS 100% 4.050 2.835 N C5orf24 n/a
11 TRCN0000142172 GACTACAAGTGGCAGAAGCAT pLKO.1 443 CDS 100% 3.000 2.100 N C5orf24 n/a
12 TRCN0000144433 CCATAGAATAATGCACACCAT pLKO.1 3149 3UTR 100% 2.640 1.848 N C5orf24 n/a
13 TRCN0000122155 GCTGTTCTAAATAGATGCTTT pLKO.1 1106 3UTR 100% 4.950 2.970 N C5orf24 n/a
14 TRCN0000143587 GTAGAGGAAACTAGCAGTGAA pLKO.1 774 CDS 100% 4.950 2.970 N C5orf24 n/a
15 TRCN0000142615 GCTGGACTTTATGCTGCTCTT pLKO.1 2755 3UTR 100% 4.050 2.430 N C5orf24 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001135586.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_04895 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_04895 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000467217 ATGGTAGCGTTTTAACGACATATG pLX_317 36.3% 100% 100% V5 n/a
Download CSV