Construct: ORF TRCN0000467284
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF005536.1_s317c1
- Derived from:
- ccsbBroadEn_01396
- DNA Barcode:
- CAGCAGTTCGGTCAGAAGCTAACC
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- RGS4 (5999)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000467284
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- n/a
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 5999 | RGS4 | regulator of G protein sign... | NM_005613.5 | 100% | 100% | |
| 2 | human | 5999 | RGS4 | regulator of G protein sign... | NM_001113380.1 | 91.2% | 91.2% | 0_1ins54 |
| 3 | human | 5999 | RGS4 | regulator of G protein sign... | NM_001102445.2 | 67.8% | 67.8% | 1_291del |
| 4 | human | 5999 | RGS4 | regulator of G protein sign... | NM_001113381.1 | 45.3% | 37% | 211_212ins167;279_280ins169 |
| 5 | mouse | 19736 | Rgs4 | regulator of G-protein sign... | NM_009062.3 | 89.4% | 96% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 681
- ORF length:
- 615
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatgtg caaagggctt gcaggtctgc cggcttcttg cttgaggagt gcaaaagata 121 tgaaacatcg gctaggtttc ctgctgcaaa aatctgattc ctgtgaacac aattcttccc 181 acaacaagaa ggacaaagtg gttatttgcc agagagtgag ccaagaggaa gtcaagaaat 241 gggctgaatc actggaaaac ctgattagtc atgaatgtgg gctggcagct ttcaaagctt 301 tcttgaagtc tgaatatagt gaggagaata ttgacttctg gatcagctgt gaagagtaca 361 agaaaatcaa atCACCATCT AAACTAAGTC CCAAGGCCAA AAAGATCTAT AATGAATTCA 421 TCTCAGTCCA GGCAACCAAA GAGGTGAACC TGGATTCTTG CACCAGGGAA GAGACAAGCC 481 GGAACATGCT AGAGCCTACA ATAACCTGCT TTGATGAGGC CCAGAAGAAG ATTTTCAACC 541 TGATGGAGAA GGATTCCTAC CGCCGCTTCC TCAAGTCTCG ATTCTATCTT GATTTGGTCA 601 ACCCGTCCAG CTGTGGGGCA GAAAAGCAGA AAGGAGCCAA GAGTTCAGCA GACTGTGCTT 661 CCCTGGTCCC TCAGTGTGCC TACCCAACTT TCTTGTACAA AGTGGTTGAT ATCGGTAAGC 721 CTATCCCTAA CCCTCTCCTC GGTCTCGATT CTACGTAGTA ATGAACTAGT CCGTAACTTG 781 AAAGTATTTC GATTTCTTGG CTTTATATAT CTTGTGGAAA GGACGACAGC AGTTCGGTCA 841 GAAGCTAACC ACGCGTTAAG TCgacaatca acctctggat tacaaaattt gtgaaagatt