Transcript: Human NM_001113380.1

Homo sapiens regulator of G protein signaling 4 (RGS4), transcript variant 3, mRNA.

Source:
NCBI, updated 2019-08-04
Taxon:
Homo sapiens (human)
Gene:
RGS4 (5999)
Length:
3055
CDS:
250..813

Additional Resources:

NCBI RefSeq record:
NM_001113380.1
NBCI Gene record:
RGS4 (5999)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001113380.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000427359 TGAGTCACTTCTACGCATAAA pLKO_005 947 3UTR 100% 13.200 18.480 N RGS4 n/a
2 TRCN0000424947 ATCCACATTGTAGCCTAATAT pLKO_005 907 3UTR 100% 15.000 10.500 N RGS4 n/a
3 TRCN0000419611 CCCACAACAAGAAGGACAAAG pLKO_005 308 CDS 100% 10.800 7.560 N RGS4 n/a
4 TRCN0000014310 CTTCCTCAAGTCTCGATTCTA pLKO.1 696 CDS 100% 5.625 3.938 N RGS4 n/a
5 TRCN0000014309 GAGCCTACAATAACCTGCTTT pLKO.1 622 CDS 100% 4.950 3.465 N RGS4 n/a
6 TRCN0000014308 GCCAATATAATGGGCTGCAAA pLKO.1 2520 3UTR 100% 4.950 3.465 N RGS4 n/a
7 TRCN0000014311 ACCATCTAAACTAAGTCCCAA pLKO.1 504 CDS 100% 2.640 1.848 N RGS4 n/a
8 TRCN0000014312 AGCCAAGAGGAAGTCAAGAAA pLKO.1 349 CDS 100% 5.625 3.375 N RGS4 n/a
9 TRCN0000034453 AGCAGAAAGGAGCCAAGAGTT pLKO.1 755 CDS 100% 4.950 2.970 N Rgs4 n/a
10 TRCN0000034449 GAAGTCAAGAAATGGGCTGAA pLKO.1 358 CDS 100% 4.050 2.430 N Rgs4 n/a
11 TRCN0000166364 CACACACACACACACACACAA pLKO.1 1357 3UTR 100% 4.950 2.475 Y KAAG1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001113380.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01396 pDONR223 100% 91.2% 91.2% None 0_1ins54 n/a
2 ccsbBroad304_01396 pLX_304 0% 91.2% 91.2% V5 0_1ins54 n/a
3 TRCN0000467284 CAGCAGTTCGGTCAGAAGCTAACC pLX_317 50.2% 91.2% 91.2% V5 0_1ins54 n/a
Download CSV