Construct: ORF TRCN0000467348
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF017053.1_s317c1
- Derived from:
- ccsbBroadEn_15488
- DNA Barcode:
- CCCAAAGGATTCGTGCTTCAACGT
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- RPSA (3921)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000467348
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
---|---|---|---|---|---|---|---|---|
1 | human | 3921 | RPSA | ribosomal protein SA | NM_002295.6 | 99.8% | 99.6% | 343G>A |
2 | human | 388524 | RPSAP58 | ribosomal protein SA pseudo... | NM_001355283.2 | 99.4% | 98.6% | (many diffs) |
3 | human | 388524 | RPSAP58 | ribosomal protein SA pseudo... | NM_001355287.2 | 99.4% | 98.6% | (many diffs) |
4 | human | 3921 | RPSA | ribosomal protein SA | NM_001304288.2 | 98.2% | 98% | 252_266del;358G>A |
5 | human | 204010 | RPSAP52 | ribosomal protein SA pseudo... | NR_026825.2 | 70.2% | (many diffs) | |
6 | human | 653162 | RPSAP9 | ribosomal protein SA pseudo... | NR_026890.1 | 59.8% | (many diffs) | |
7 | mouse | 16785 | Rpsa | ribosomal protein SA | NM_011029.4 | 88.8% | 98.9% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 951
- ORF length:
- 885
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatgtc cggagccctt gatgtcctgc aaatgaagga ggaggatgtc cttaagttcc 121 ttgcagcagg aacccactta ggtggcacca atcttgactt ccagatggaa cagtacatct 181 ataaaaggaa aagtgatggc atctatatca taaatctcaa gaggacctgg gagaagcttc 241 tgctggcagc tcgtgcaatt gttgccattg aaaaccctgc tgatgtcagt gttatatcct 301 ccaggaatac tggccagagg gctgtgctga agtttgctgc tgccactgga gccactccaa 361 ttgctggccg cttcactcct ggaaccttca ctaaccagat ccaggcaacc ttccgggagc 421 cacggcttct tgtggttact gaccccaggg ctgaccacca gcctctcacg gaggcatctt 481 atgttaacct acctaccatt gcgctgtgta acacagattc tcctctgcgc tatgtggaca 541 ttgccatccc atgcaacaac aagggagctc actcagtggg tttgatgtgg tggatgctgg 601 ctcgggaagt tctgcgcatg cgtggcacca tttcccgtga acacccatgg gaggtcatgc 661 cTGATCTGTA CTTCTACAGA GATCCTGAAG AGATTGAAAA AGAAGAGCAG GCTGCTGCTG 721 AGAAGGCAGT GACCAAGGAG GAATTTCAGG GTGAATGGAC TGCTCCCGCT CCTGAGTTCA 781 CTGCTACTCA GCCTGAGGTT GCAGACTGGT CTGAAGGTGT ACAGGTGCCC TCTGTGCCTA 841 TTCAGCAATT CCCTACTGAA GACTGGAGCG CTCAGCCTGC CACGGAAGAC TGGTCTGCAG 901 CTCCCACTGC TCAGGCCACT GAATGGGTAG GAGCAACCAC TGACTGGTCT TACCCAACTT 961 TCTTGTACAA AGTGGTTGAT ATCGGTAAGC CTATCCCTAA CCCTCTCCTC GGTCTCGATT 1021 CTACGTAGTA ATGAACTAGT CCGTAACTTG AAAGTATTTC GATTTCTTGG CTTTATATAT 1081 CTTGTGGAAA GGACGACCCA AAGGATTCGT GCTTCAACGT ACGCGTTAAG TCgacaatca 1141 acctctggat tacaaaattt gtgaaagatt