Transcript: Human NM_002295.6

Homo sapiens ribosomal protein SA (RPSA), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-08-26
Taxon:
Homo sapiens (human)
Gene:
RPSA (3921)
Length:
1140
CDS:
79..966

Additional Resources:

NCBI RefSeq record:
NM_002295.6
NBCI Gene record:
RPSA (3921)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_002295.6, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000029481 CGTGCAATTGTTGCCATTGAA pLKO.1 265 CDS 100% 5.625 3.375 N RPSA n/a
2 TRCN0000269876 ATGGAACAGTACATCTATAAA pLKO_005 178 CDS 100% 15.000 7.500 Y RPSAP47 n/a
3 TRCN0000155495 CACGGAGGCATCTTATGTTAA pLKO.1 480 CDS 100% 13.200 6.600 Y RPSAP58 n/a
4 TRCN0000029479 CCTGCTGATGTCAGTGTTATA pLKO.1 289 CDS 100% 13.200 6.600 Y RPSA n/a
5 TRCN0000343311 CCTGCTGATGTCAGTGTTATA pLKO_005 289 CDS 100% 13.200 6.600 Y RPSA n/a
6 TRCN0000029480 GCAGTGACCAAGGAGGAATTT pLKO.1 739 CDS 100% 13.200 6.600 Y RPSA n/a
7 TRCN0000343361 GCAGTGACCAAGGAGGAATTT pLKO_005 739 CDS 100% 13.200 6.600 Y RPSA n/a
8 TRCN0000269929 TGCTGATGTCAGTGTTATATC pLKO_005 291 CDS 100% 13.200 6.600 Y RPSAP47 n/a
9 TRCN0000155937 CTCTGTGCCTATTCAGCAATT pLKO.1 843 CDS 100% 10.800 5.400 Y RPSAP58 n/a
10 TRCN0000269930 TTGCAGCAGGAACCCACTTAG pLKO_005 134 CDS 100% 10.800 5.400 Y RPSAP47 n/a
11 TRCN0000158297 CCTCTGTGCCTATTCAGCAAT pLKO.1 842 CDS 100% 4.950 2.475 Y RPSAP58 n/a
12 TRCN0000155989 CCTATTCAGCAATTCCCTACT pLKO.1 850 CDS 100% 4.050 2.025 Y RPSAP58 n/a
13 TRCN0000155990 CAGTGTTATATCCTCCAGGAA pLKO.1 300 CDS 100% 2.640 1.320 Y RPSAP58 n/a
14 TRCN0000156506 GCACCAATCTTGACTTCCAGA pLKO.1 158 CDS 100% 2.640 1.320 Y RPSAP58 n/a
15 TRCN0000029483 CCAGATGGAACAGTACATCTA pLKO.1 174 CDS 100% 0.495 0.248 Y RPSA n/a
16 TRCN0000343360 CCAGATGGAACAGTACATCTA pLKO_005 174 CDS 100% 0.495 0.248 Y RPSA n/a
17 TRCN0000029482 GATCTGTACTTCTACAGAGAT pLKO.1 676 CDS 100% 0.495 0.248 Y RPSA n/a
18 TRCN0000343312 GATCTGTACTTCTACAGAGAT pLKO_005 676 CDS 100% 0.495 0.248 Y RPSA n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_002295.6, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_00928 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_00928 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000480498 TGTGTCTACAAGCTAGTGTCGGGG pLX_317 45.8% 100% 100% V5 n/a
4 ccsbBroadEn_06513 pDONR223 100% 99.8% 100% None 519G>A n/a
5 ccsbBroad304_06513 pLX_304 0% 99.8% 100% V5 519G>A n/a
6 TRCN0000480590 GTTTGACGGTCTTCTCATCGACAG pLX_317 48.3% 99.8% 100% V5 519G>A n/a
7 ccsbBroadEn_15488 pDONR223 0% 99.8% 99.6% None 343G>A n/a
8 ccsbBroad304_15488 pLX_304 0% 99.8% 99.6% V5 343G>A n/a
9 TRCN0000467348 CCCAAAGGATTCGTGCTTCAACGT pLX_317 33.1% 99.8% 99.6% V5 343G>A n/a
10 ccsbBroadEn_06514 pDONR223 100% 99.8% 99.6% None 641A>G n/a
11 ccsbBroad304_06514 pLX_304 0% 99.8% 99.6% V5 641A>G n/a
12 TRCN0000470809 AGGGCGAGCTCTTGTAAACTGAAA pLX_317 51.3% 99.8% 99.6% V5 641A>G n/a
13 ccsbBroadEn_10093 pDONR223 100% 99.5% 99.3% None (many diffs) n/a
14 ccsbBroad304_10093 pLX_304 0% 99.5% 99.3% V5 (many diffs) n/a
15 TRCN0000475739 TTTACGTGGAAGTGGGGCCGGATC pLX_317 33% 99.5% 99.3% V5 (many diffs) n/a
16 ccsbBroadEn_10325 pDONR223 100% 61.1% 31.9% None (many diffs) n/a
17 ccsbBroad304_10325 pLX_304 0% 61.1% 31.9% V5 (many diffs) n/a
18 TRCN0000475380 GGCCCCGGATGCCGGCCGCCGCCA pLX_317 35.3% 61.1% 31.9% V5 (many diffs) n/a
Download CSV