Construct: ORF TRCN0000467434
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF013683.1_s317c1
- Derived from:
- ccsbBroadEn_03068
- DNA Barcode:
- CTCTATCCAATTCTCGAACTCACC
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- ZBTB44 (29068)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000467434
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- n/a
Current transcripts matched by this ORF:
Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
---|---|---|---|---|---|---|---|---|
1 | human | 29068 | ZBTB44 | zinc finger and BTB domain ... | NM_014155.4 | 100% | 100% | |
2 | human | 29068 | ZBTB44 | zinc finger and BTB domain ... | XM_006718826.4 | 96.2% | 96.2% | 1102_1103ins51 |
3 | human | 29068 | ZBTB44 | zinc finger and BTB domain ... | NM_001370221.1 | 96% | 96% | 1102_1103ins54 |
4 | human | 29068 | ZBTB44 | zinc finger and BTB domain ... | NM_001301099.1 | 95.4% | 95.1% | 1352_1375del;1381_1382delGAinsTC;1384_1422del |
5 | human | 29068 | ZBTB44 | zinc finger and BTB domain ... | NM_001370223.1 | 95.4% | 95.1% | 1352_1375del;1381_1382delGAinsTC;1384_1422del |
6 | human | 29068 | ZBTB44 | zinc finger and BTB domain ... | NM_001301098.2 | 79.3% | 78.9% | 1352_1359delGTAAACGC;1361_1362insA;1367_1710del |
7 | human | 29068 | ZBTB44 | zinc finger and BTB domain ... | XM_024448456.1 | 79.3% | 78.9% | 1352_1359delGTAAACGC;1361_1362insA;1367_1710del |
8 | human | 29068 | ZBTB44 | zinc finger and BTB domain ... | NM_001370219.1 | 73.4% | 73% | 1352_1359delGTAAACGC;1361_1362insA;1367_1848del |
9 | human | 29068 | ZBTB44 | zinc finger and BTB domain ... | XM_006718825.4 | 70.6% | 70.2% | (many diffs) |
10 | human | 29068 | ZBTB44 | zinc finger and BTB domain ... | NM_001370220.1 | 70.5% | 70.1% | (many diffs) |
11 | human | 29068 | ZBTB44 | zinc finger and BTB domain ... | NR_163264.1 | 32.6% | (many diffs) | |
12 | human | 29068 | ZBTB44 | zinc finger and BTB domain ... | XR_246423.5 | 19.8% | 1_266del;1626_6849del | |
13 | human | 29068 | ZBTB44 | zinc finger and BTB domain ... | XR_246421.5 | 17.3% | (many diffs) | |
14 | human | 29068 | ZBTB44 | zinc finger and BTB domain ... | NR_163265.1 | 14.9% | (many diffs) | |
15 | human | 29068 | ZBTB44 | zinc finger and BTB domain ... | XR_002957142.1 | 14.5% | (many diffs) | |
16 | mouse | 235132 | Zbtb44 | zinc finger and BTB domain ... | NM_001115130.1 | 91.8% | 96.4% | (many diffs) |
17 | mouse | 235132 | Zbtb44 | zinc finger and BTB domain ... | NM_172765.3 | 88.1% | 92.4% | (many diffs) |
18 | mouse | 235132 | Zbtb44 | zinc finger and BTB domain ... | XM_006510215.3 | 67.4% | 70.4% | (many diffs) |
19 | mouse | 235132 | Zbtb44 | zinc finger and BTB domain ... | XM_006510216.3 | 64.9% | 67.6% | (many diffs) |
20 | mouse | 235132 | Zbtb44 | zinc finger and BTB domain ... | XM_006510217.3 | 64.7% | 67.5% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 1425
- ORF length:
- 1359
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatggg tgtgaaaaca tttactcata gctcctcttc ccacagccag gaaatgcttg 121 gaaagctaaa tatgctgcga aatgatggac atttttgtga tatcactatt cgtgtccagg 181 acaaaatctt ccgggcacat aaggtggtac tagcagcttg cagtgatttc tttcgcacca 241 aacttgtagg ccaagccgag gatgagaaca agaatgtgtt ggatctgcat catgttacag 301 tgactggctt tatacctctt ttagaatatg cttacacagc cactctatca attaacacag 361 aaaatattat tgatgttcta gcagcagcca gctatatgca aatgttcagt gttgccagca 421 cctgctcaga gttcatgaaa tcaagcattt tatggaatac acccaacagc caacctgaaa 481 agggtctaga tgctggacaa gaaaataatt ctaactgcaa ttttacttct cgagatggga 541 gcatttctcc cgtgtcctca gagtgcagtg tggtagaaag aaccattcct gtctgccgag 601 aatcccggag aaagcgcaaa agctacattg ttatgtctcc tgaaagtcct gtaaagtgtg 661 gcacacaaac aagctcaccc caggtattga attcttcagc ttcctactca gaaaatagaa 721 accaaccagt tgactcttcc ttagcttttc cttggacttt tccttttgga attgatcgaa 781 ggattcagcc tgagaaagtt aagcaagcag aaaatacccg gactttagaa ttacctggcc 841 catctgagac cggtagaaga atggctgatt atgtgacttg tgagagcaca aaaactacct 901 tgcctttagg taccgaagaa gatgtccggg tcaaagtaga aagattaagt gatgaggagg 961 tccatgagga agtgtcccag cctgtcagtg catctcagag ttcgctgagt gatcagcaga 1021 cagttccagg aagtgaacaa gtccaagagg accttctgat tagtccacag tcttcctcta 1081 taggctcagt agatgaaggc gttTCTGAGG GCTTGCCTAC ACTTCAAAGC ACGTCTAGCA 1141 CTAATGCTCC TCCGGATGAT GATGATCGAT TGGAAAATGT TCAGTATCCC TACCAACTCT 1201 ACATTGCTCC TTCCACCAGC AGTACAGAGC GACCAAGTCC AAATGGTCCC GACAGACCTT 1261 TTCAGTGTCC AACCTGCGGG GTGCGATTCA CCCGTATTCA GAACCTAAAG CAGCACATGC 1321 TCATCCACTC AGGAATTAAA CCATTTCAGT GTGACCGCTG TGGGAAAAAG TTCACCAGGG 1381 CTTACTCGCT AAAGATGCAT CGCCTAAAGC ATGAAGTGAT TTCCTACCCA ACTTTCTTGT 1441 ACAAAGTGGT TGATATCGGT AAGCCTATCC CTAACCCTCT CCTCGGTCTC GATTCTACGT 1501 AGTAATGAAC TAGTCCGTAA CTTGAAAGTA TTTCGATTTC TTGGCTTTAT ATATCTTGTG 1561 GAAAGGACGA CTCTATCCAA TTCTCGAACT CACCACGCGT TAAGTCgaca atcaacctct 1621 ggattacaaa atttgtgaaa gatt