Transcript: Human NR_163265.1

Homo sapiens zinc finger and BTB domain containing 44 (ZBTB44), transcript variant 10, non-coding RNA.

Source:
NCBI, updated 2019-05-02
Taxon:
Homo sapiens (human)
Gene:
ZBTB44 (29068)
Length:
9098
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
NR_163265.1
NBCI Gene record:
ZBTB44 (29068)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NR_163265.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000134224 GAATGGCTGATTATGTGACTT pLKO.1 1393 3UTR 100% 4.950 6.930 N ZBTB44 n/a
2 TRCN0000135240 CCTTTAGGTACCGAAGAAGAT pLKO.1 1437 3UTR 100% 0.000 0.000 N ZBTB44 n/a
3 TRCN0000177983 GTGTTGGATCTGCATCATGTT pLKO.1 810 3UTR 100% 4.950 3.960 N Zbtb44 n/a
4 TRCN0000135171 CGGTAGAAGAATGGCTGATTA pLKO.1 1385 3UTR 100% 13.200 9.240 N ZBTB44 n/a
5 TRCN0000136439 CTCCTGAAAGTCCTGTAAAGT pLKO.1 1171 3UTR 100% 5.625 3.938 N ZBTB44 n/a
6 TRCN0000135542 GTCTAGATGCTGGACAAGAAA pLKO.1 1018 3UTR 100% 5.625 3.938 N ZBTB44 n/a
7 TRCN0000136245 GAAACCAACCAGTTGACTCTT pLKO.1 1252 3UTR 100% 4.950 3.465 N ZBTB44 n/a
8 TRCN0000135239 CAGTTGACTCTTCCTTAGCTT pLKO.1 1261 3UTR 100% 3.000 2.100 N ZBTB44 n/a
9 TRCN0000133787 CTGATTATGTGACTTGTGAGA pLKO.1 1399 3UTR 100% 2.640 1.848 N ZBTB44 n/a
10 TRCN0000136374 CTTTAGAATTACCTGGCCCAT pLKO.1 1357 3UTR 100% 2.160 1.512 N ZBTB44 n/a
11 TRCN0000137052 CAGCAGCCAGCTATATGCAAA pLKO.1 916 3UTR 100% 4.950 2.970 N ZBTB44 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NR_163265.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_11895 pDONR223 100% 18.7% None (many diffs) n/a
2 ccsbBroad304_11895 pLX_304 0% 18.7% V5 (many diffs) n/a
3 TRCN0000468605 GCCCCTGCTGCTCTCGCGGCTCCA pLX_317 22% 18.7% V5 (many diffs) n/a
4 ccsbBroadEn_11896 pDONR223 100% 15.3% None (many diffs) n/a
5 ccsbBroad304_11896 pLX_304 0% 15.3% V5 (many diffs) n/a
6 TRCN0000478537 TGGCACACAGCGGGCTTGATAATA pLX_317 28.6% 15.3% V5 (many diffs) n/a
7 ccsbBroadEn_03068 pDONR223 100% 14.9% None (many diffs) n/a
8 ccsbBroad304_03068 pLX_304 0% 14.9% V5 (many diffs) n/a
9 TRCN0000467434 CTCTATCCAATTCTCGAACTCACC pLX_317 24% 14.9% V5 (many diffs) n/a
Download CSV