Construct: ORF TRCN0000467707
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF012574.1_s317c1
- Derived from:
- ccsbBroadEn_15906
- DNA Barcode:
- ATCTATTCCAGACCAGTGACCACC
- Epitope Tag:
- V5 (not translated due to prior stop codon)
- Notes:
- Early stop codon detected
Originally Annotated References:
- Gene:
- SLC48A1 (55652)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000467707
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- n/a
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 55652 | SLC48A1 | solute carrier family 48 me... | XM_017019612.1 | 54.9% | 49.3% | 344_347delTTTT;399_717del |
| 2 | human | 55652 | SLC48A1 | solute carrier family 48 me... | XM_017019614.2 | 54.9% | 49.3% | 344_347delTTTT;399_717del |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 420
- ORF length:
- 354
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatgcc caccgctacc gggctgactt tgctgacatc agcatcctca gcgatttctg 121 acccaggggg tgaggtctct gcaccctggg ggggccttag gacctggact cagcctctga 181 gatgttggga gaggctactc ccaccccctg gtgaccccag aactgtggca gaaaatacac 241 agcaggacga gtgtggtcTC CCAGGAAGCT GTCCTGCCCG TCCCCTTTCG AGGAAACCTG 301 AGTGTGGTAG AGAGGGGATC CTGCCATGTT GCTCCTCATC AGCCTGGCCA GAGGGCAGCT 361 TTAGACCTTT TCAAATGAAT CTGTTTTCTT TTCTTTCTTT TTTTTTTCTT TTTTTTTTTT 421 GAGATGGAGT CTTACTCTGT CACCCAGGCT GGAGTGCAGT ACCCAACTTT CTTGTACAAA 481 GTGGTTGATA TCGGTAAGCC TATCCCTAAC CCTCTCCTCG GTCTCGATTC TACGTAGTAA 541 TGAACTAGTC CGTAACTTGA AAGTATTTCG ATTTCTTGGC TTTATATATC TTGTGGAAAG 601 GACGAATCTA TTCCAGACCA GTGACCACCA CGCGTTAAGT Cgacaatcaa cctctggatt 661 acaaaatttg tgaaagatt