Construct: ORF TRCN0000467708
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF005563.1_s317c1
- Derived from:
- ccsbBroadEn_07290
- DNA Barcode:
- CGGAAGTCAGGACTTAGCCGTTAC
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- B4GALT3 (8703)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000467708
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- n/a
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 8703 | B4GALT3 | beta-1,4-galactosyltransfer... | NM_001199873.1 | 99.8% | 100% | 267G>A;528C>T |
| 2 | human | 8703 | B4GALT3 | beta-1,4-galactosyltransfer... | NM_001199874.1 | 99.8% | 100% | 267G>A;528C>T |
| 3 | human | 8703 | B4GALT3 | beta-1,4-galactosyltransfer... | NM_003779.4 | 99.8% | 100% | 267G>A;528C>T |
| 4 | human | 8703 | B4GALT3 | beta-1,4-galactosyltransfer... | XM_005245566.2 | 99.8% | 100% | 267G>A;528C>T |
| 5 | human | 8703 | B4GALT3 | beta-1,4-galactosyltransfer... | XM_024450540.1 | 99.8% | 100% | 267G>A;528C>T |
| 6 | human | 8703 | B4GALT3 | beta-1,4-galactosyltransfer... | XM_024450541.1 | 99.8% | 100% | 267G>A;528C>T |
| 7 | human | 8703 | B4GALT3 | beta-1,4-galactosyltransfer... | XM_011510093.2 | 78.7% | 77.6% | (many diffs) |
| 8 | human | 8703 | B4GALT3 | beta-1,4-galactosyltransfer... | XM_017002714.2 | 78.7% | 77.6% | (many diffs) |
| 9 | human | 8703 | B4GALT3 | beta-1,4-galactosyltransfer... | XR_002957951.1 | 44.3% | (many diffs) | |
| 10 | human | 8703 | B4GALT3 | beta-1,4-galactosyltransfer... | XR_002957952.1 | 39.2% | (many diffs) | |
| 11 | mouse | 57370 | B4galt3 | UDP-Gal:betaGlcNAc beta 1,4... | NM_020579.2 | 88.3% | 96.2% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 1245
- ORF length:
- 1179
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatgtt gcggaggctg ctggagcggc cttgcacgct ggccctgctt gtgggctccc 121 agctggctgt catgatgtac ctgtcactgg ggggcttccg aagtctcagt gccctatttg 181 gccgagatca gggaccgaca tttgactatt ctcaccctcg tgatgtctac agtaacctca 241 gtcacctgcc tggggcccca gggggtcctc cagctcctca aggtctgccc tactgtccag 301 aacgatctcc tctcttagtg ggtcctgtgt cagtgtcctt tagcccagtg ccatcactgg 361 cagagattgt ggagcggaat ccccgggtag aaccaggggg ccggtaccgc cctgcaggtt 421 gtgagccccg ctcccgaaca gccatcattg tgcctcatcg tgcccgggag caccacctgc 481 gcctgctgct ctaccacctg caccccttct tgcagcgcca gcagcttgct tatggcatct 541 atgtcatcca ccaggctgga aatggaacat ttaacagggc aaaactgttg aatgttgggg 601 tgcgagaggc cctgcgtgat gaagagtggg actgcctgtt cttgcacgat gtggacctct 661 tgccagaaaa tgaccacaat ctgtatgtgt gtgacccccg gggaccccgc catgttgccg 721 ttgctatgaa caagtttgga tacagcctcc cgtaccccca gtacttcgga ggagtctcag 781 cacttactcc tgaccagtac ctgaagatga atggcttccc caatgaatac tggggctggg 841 gtggtgagga tgacgacatt gctaccaggg tgcgcctggc tgggatgaag atctctcggc 901 cccccacatc tgtaggacac tataagatgg tgaagcaccg aggagataag ggcaatgagg 961 aaaatcccca cagatttgac cTCCTGGTCC GTACCCAGAA TTCCTGGACG CAAGATGGGA 1021 TGAACTCACT GACATACCAG TTGCTGGCTC GAGAGCTGGG GCCTCTTTAT ACCAACATCA 1081 CAGCAGACAT TGGGACTGAC CCTCGGGGTC CTCGGGCTCC TTCTGGGCCA CGTTACCCAC 1141 CTGGTTCCTC CCAAGCCTTC CGTCAAGAGA TGCTGCAACG CCGGCCCCCA GCCAGGCCTG 1201 GGCCTCTATC TACTGCCAAC CACACAGCCC TCCGAGGTTC ACACTGCCCA ACTTTCTTGT 1261 ACAAAGTGGT TGATATCGGT AAGCCTATCC CTAACCCTCT CCTCGGTCTC GATTCTACGT 1321 AGTAATGAAC TAGTCCGTAA CTTGAAAGTA TTTCGATTTC TTGGCTTTAT ATATCTTGTG 1381 GAAAGGACGA CGGAAGTCAG GACTTAGCCG TTACACGCGT TAAGTCgaca atcaacctct 1441 ggattacaaa atttgtgaaa gatt