Transcript: Human NM_001199874.1

Homo sapiens beta-1,4-galactosyltransferase 3 (B4GALT3), transcript variant 3, mRNA.

Source:
NCBI, updated 2019-06-18
Taxon:
Homo sapiens (human)
Gene:
B4GALT3 (8703)
Length:
2367
CDS:
657..1838

Additional Resources:

NCBI RefSeq record:
NM_001199874.1
NBCI Gene record:
B4GALT3 (8703)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001199874.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000035292 CGAAGTCTCAGTGCCCTATTT pLKO.1 750 CDS 100% 13.200 10.560 N B4GALT3 n/a
2 TRCN0000232472 CGAAGTCTCAGTGCCCTATTT pLKO_005 750 CDS 100% 13.200 10.560 N B4GALT3 n/a
3 TRCN0000232475 CACATCTGTAGGACACTATAA pLKO_005 1496 CDS 100% 13.200 9.240 N B4GALT3 n/a
4 TRCN0000035291 CCACATCTGTAGGACACTATA pLKO.1 1495 CDS 100% 13.200 9.240 N B4GALT3 n/a
5 TRCN0000232473 CGAGATCAGGGACCGACATTT pLKO_005 774 CDS 100% 13.200 9.240 N B4GALT3 n/a
6 TRCN0000232476 AGGGTCTCCTGTAGGGCTTAT pLKO_005 2029 3UTR 100% 10.800 7.560 N B4GALT3 n/a
7 TRCN0000232474 GTGGTGAGGATGACGACATTG pLKO_005 1432 CDS 100% 10.800 7.560 N B4GALT3 n/a
8 TRCN0000035293 CCAGGCTGGAAATGGAACATT pLKO.1 1142 CDS 100% 5.625 3.938 N B4GALT3 n/a
9 TRCN0000035290 CCCTCGTGATGTCTACAGTAA pLKO.1 806 CDS 100% 4.950 3.465 N B4GALT3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001199874.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01992 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_01992 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000472294 GGTTTTTAACCCTTTATCTTTTCC pLX_317 36.7% 100% 100% V5 n/a
4 ccsbBroadEn_07290 pDONR223 100% 99.8% 100% None 267G>A;528C>T n/a
5 ccsbBroad304_07290 pLX_304 0% 99.8% 100% V5 267G>A;528C>T n/a
6 TRCN0000467708 CGGAAGTCAGGACTTAGCCGTTAC pLX_317 22.8% 99.8% 100% V5 267G>A;528C>T n/a
Download CSV