Construct: ORF TRCN0000467818
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF002299.1_s317c1
- Derived from:
- ccsbBroadEn_10724
- DNA Barcode:
- TCCAAAGTCTGGACCAAAGCTACC
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- CDH6 (1004)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000467818
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
---|---|---|---|---|---|---|---|---|
1 | human | 1004 | CDH6 | cadherin 6 | NM_001362435.2 | 99.7% | 100% | (many diffs) |
2 | human | 1004 | CDH6 | cadherin 6 | NM_004932.4 | 81.8% | 79.7% | (many diffs) |
3 | human | 1004 | CDH6 | cadherin 6 | XM_011513921.3 | 81.8% | 79.7% | (many diffs) |
4 | human | 1004 | CDH6 | cadherin 6 | XM_017008910.2 | 81.8% | 79.7% | (many diffs) |
5 | human | 1004 | CDH6 | cadherin 6 | XR_001741972.2 | 40.2% | (many diffs) | |
6 | mouse | 12563 | Cdh6 | cadherin 6 | XM_006520018.3 | 90.4% | 96.5% | (many diffs) |
7 | mouse | 12563 | Cdh6 | cadherin 6 | XM_017316420.1 | 90.4% | 96.5% | (many diffs) |
8 | mouse | 12563 | Cdh6 | cadherin 6 | NM_007666.4 | 74.7% | 77.5% | (many diffs) |
9 | mouse | 12563 | Cdh6 | cadherin 6 | XM_006520017.1 | 74.7% | 77.5% | (many diffs) |
10 | mouse | 12563 | Cdh6 | cadherin 6 | XM_017316421.1 | 54.7% | 57.2% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 2055
- ORF length:
- 1989
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatgag aacttaccgc tacttcttgc tgctcttttg ggtgggccag ccctacccaa 121 ctctctcaac tccactatca aagaggacta gtggtttccc agcaaagaaa agggccctgg 181 agctctctgg aaacagcaaa aatgagctga accgttcaaa aaggagctgg atgtggaatc 241 agttctttct cctggaggaa tacacaggat ccgattatca gtatgtgggc aagttacatt 301 cagaccagga tagaggagat ggatcactta aatatatcct ttcaggagat ggagcaggag 361 atctcttcat tattaatgaa aacacaggcg acatacaggc caccaagagg ctggacaggg 421 aagaaaaacc cgtttacatc cttcgagctc aagctataaa cagaaggaca gggagacccg 481 tggagcccga gtctgaattc atcatcaaga tccatgacat caatgacaat gaaccaatat 541 tcaccaagga ggtttacaca gccactgtcc ctgaaatgtc tgatgtcggt acatttgttg 601 tccaagtcac tgcgacggat gcagatgatc caacatatgg gaacagtgct aaagttgtct 661 acagtattct acagggacag ccctattttt cagttgaatc agaaacaggt attatcaaga 721 cagctttgct caacatggat cgagaaaaca gggagcagta ccaagtggtg attcaagcca 781 aggatatggg cggccagatg ggaggattat ctgggaccac caccgtgaac atcacactga 841 ctgatgtcaa cgacaaccct ccccgattcc cccagagtac ataccagttt aaaactcctg 901 aatcttctcc accggggaca ccaattggca gaatcaaagc cagcgatgct gatgtgggag 961 aaaatgctga aattgagtac agcatcacag acggtgaggg gctggatatg tttgatgtca 1021 tcaccgacca ggaaacccag gaagggatta taactgtcaa aaagctcttg gactttgaaa 1081 agaagaaagt gtataccctt aaagtggaag cctccaatcc ttatgttgag ccacgatttc 1141 tctacttggg gcctttcaaa gattcagcca cggttagaat tgtggtggag gatgtagatg 1201 agccacctgt cttcagcaaa ctggcctaca tcttacaaat aagagaagat gctcagataa 1261 acaccacaat aggctccgtc acagcccaag atccagatgc tgccaggaat cctgtcaagt 1321 actctgtaga tcgacacaca gatatggaca gaatattcaa cattgattct ggaaatggtt 1381 cgatttttac atcgaaactt cttgaccgag aaacactgct atggcacaac attacagtga 1441 tagcaacaga gatcaataat ccaaagcaaa gtagtcgagt acctctatat attaaagttc 1501 tagatgtcaa tgacaacgcc ccagaatttg ctgagttcta tgaaactttt gtctgtgaaa 1561 aagcaaaggc agatcagttg attcagacct tgcatgctgt tgacaaggat gacccttata 1621 gtgggcacca attttcgttt tccttggccc ctgaagcagc cagtggctca aactttacca 1681 ttcaagacaa caaagacaac acggcgggaa tcttaactcG GAAAAATGGC TATAATAGAC 1741 ACGAGATGAG CACCTATCTC TTGCCTGTGG TCATTTCAGA CAACGACTAC CCAGTTCAAA 1801 GCAGCACTGG GACAGTGACT GTCCGGGTCT GTGCATGTGA CCACCACGGG AACATGCAAT 1861 CCTGCCACGC GGAGGCGCTC ATCCACCCCA CGGGACTGAG CACGGGGGCT CTGGTTGCCA 1921 TCCTTCTGTG CATCGTGATC CTACTAGGTA AACTGGTTCT CCCTGCCTCC TATCTCCCCA 1981 TGGTGAGGGG CTCACACTGT TACTGTGACA CTCTAGATTT ATCTGCCTCC CCCATTAAGG 2041 CATACAGCCT GATCTACCCA ACTTTCTTGT ACAAAGTGGT TGATATCGGT AAGCCTATCC 2101 CTAACCCTCT CCTCGGTCTC GATTCTACGT AGTAATGAAC TAGTCCGTAA CTTGAAAGTA 2161 TTTCGATTTC TTGGCTTTAT ATATCTTGTG GAAAGGACGA TCCAAAGTCT GGACCAAAGC 2221 TACCACGCGT TAAGTCgaca atcaacctct ggattacaaa atttgtgaaa gatt