Transcript: Mouse NM_007666.4

Mus musculus cadherin 6 (Cdh6), mRNA.

Source:
NCBI, updated 2017-06-10
Taxon:
Mus musculus (mouse)
Gene:
Cdh6 (12563)
Length:
8185
CDS:
296..2668

Additional Resources:

NCBI RefSeq record:
NM_007666.4
NBCI Gene record:
Cdh6 (12563)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_007666.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000094214 GCCCGGATAAATACGACCATA pLKO.1 1481 CDS 100% 4.950 6.930 N Cdh6 n/a
2 TRCN0000094216 CGATTATCAGTACGTGGGCAA pLKO.1 502 CDS 100% 2.160 3.024 N Cdh6 n/a
3 TRCN0000094217 CCAGCAGCTCAAACTTTACTA pLKO.1 1890 CDS 100% 5.625 3.938 N Cdh6 n/a
4 TRCN0000094218 TGCTGAGTTCTATGAAACTTT pLKO.1 1759 CDS 100% 5.625 3.938 N Cdh6 n/a
5 TRCN0000178741 CACACACATACACACACACAA pLKO.1 4767 3UTR 100% 4.950 2.475 Y Cstad n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_007666.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_10724 pDONR223 100% 74.7% 77.5% None (many diffs) n/a
2 ccsbBroad304_10724 pLX_304 0% 74.7% 77.5% V5 (many diffs) n/a
3 TRCN0000467818 TCCAAAGTCTGGACCAAAGCTACC pLX_317 17.2% 74.7% 77.5% V5 (many diffs) n/a
Download CSV