Construct: ORF TRCN0000467958
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF006006.1_s317c1
- Derived from:
- ccsbBroadEn_07900
- DNA Barcode:
- AGAATATGTGCTATGTTAGCTGCA
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- TSPAN12 (23554)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000467958
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- n/a
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 23554 | TSPAN12 | tetraspanin 12 | NM_012338.4 | 99.6% | 99.3% | 170T>C;765G>T;893C>T |
| 2 | human | 23554 | TSPAN12 | tetraspanin 12 | XM_005250239.3 | 99.6% | 99.3% | 170T>C;765G>T;893C>T |
| 3 | human | 23554 | TSPAN12 | tetraspanin 12 | XM_011515993.1 | 99.6% | 99.3% | 170T>C;765G>T;893C>T |
| 4 | human | 23554 | TSPAN12 | tetraspanin 12 | XM_011515994.1 | 99.6% | 99.3% | 170T>C;765G>T;893C>T |
| 5 | human | 23554 | TSPAN12 | tetraspanin 12 | XM_017011913.1 | 91.4% | 91.1% | (many diffs) |
| 6 | mouse | 269831 | Tspan12 | tetraspanin 12 | NM_173007.3 | 89.3% | 97.3% | (many diffs) |
| 7 | mouse | 269831 | Tspan12 | tetraspanin 12 | XM_006505090.2 | 89.3% | 97.3% | (many diffs) |
| 8 | mouse | 269831 | Tspan12 | tetraspanin 12 | XM_006505091.3 | 89.3% | 97.3% | (many diffs) |
| 9 | mouse | 269831 | Tspan12 | tetraspanin 12 | XM_017321601.1 | 89.3% | 97.3% | (many diffs) |
| 10 | mouse | 269831 | Tspan12 | tetraspanin 12 | XM_017321602.1 | 89.3% | 97.3% | (many diffs) |
| 11 | mouse | 269831 | Tspan12 | tetraspanin 12 | XM_011241063.2 | 86.1% | 94% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 981
- ORF length:
- 915
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatggc cagagaagat tccgtgaagt gtctgcgctg cctgctctac gccctcaatc 121 tgctcttttg gttaatgtcc atcagtgtgt tggcagtttc tgcttggatg agggactacc 181 taaataatgt tctcacttta actgcagaaa cgagggtaga ggaagcagtc atttcgactt 241 actttcctgt ggttcatccg gtcatgattg ctgtttgctg tttccttatc attgtgggga 301 tgttaggata ttgtggaacg gtgaaaagaa atctgttgct tcttgcatgg tactttggaa 361 gtttgcttgt cattttctgt gtagaactgg cttgtggcgt ttggacatat gaacaggaac 421 ttatggttcc agtacaatgg tcagatatgg tcactttgaa agccaggatg acaaattatg 481 gattacctag atatcggtgg cttactcatg cttggaattt ttttcagaga gagtttaagt 541 gctgtggagt agtatatttc actgactggt tggaaatgac agagatggac tggcccccag 601 attccTGCTG TGTTAGAGAA TTCCCAGGAT GTTCCAAACA GGCCCACCAG GAAGATCTCA 661 GTGACCTTTA TCAAGAGGGT TGTGGGAAGA AAATGTATTC CTTTTTGAGA GGAACCAAAC 721 AACTGCAGGT GCTGAGGTTT CTGGGAATCT CCATTGGGGT GACACAAATC CTGGCCATGA 781 TTCTCACCAT TACTCTGCTC TGGGCTCTGT ATTATGATAG AAGGGAGCCT GGGACAGACC 841 AAATGATGTC CTTGAAGAAT GACAACTCTC AGCACCTGTC ATGTCCCTCA GTAGAACTGT 901 TGAAACCAAG CCTGTCAAGA ATCTTTGAAC ACACATCCAT GGCAAACAGC TTTAATATAC 961 ACTTTGAGAT GGAGGAGTTA TACCCAACTT TCTTGTACAA AGTGGTTGAT ATCGGTAAGC 1021 CTATCCCTAA CCCTCTCCTC GGTCTCGATT CTACGTAGTA ATGAACTAGT CCGTAACTTG 1081 AAAGTATTTC GATTTCTTGG CTTTATATAT CTTGTGGAAA GGACGAAGAA TATGTGCTAT 1141 GTTAGCTGCA ACGCGTTAAG TCgacaatca acctctggat tacaaaattt gtgaaagatt