Transcript: Mouse XM_017321602.1

PREDICTED: Mus musculus tetraspanin 12 (Tspan12), transcript variant X4, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Tspan12 (269831)
Length:
2403
CDS:
246..1163

Additional Resources:

NCBI RefSeq record:
XM_017321602.1
NBCI Gene record:
Tspan12 (269831)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_017321602.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000381411 ACATACGAGCAGGAGGTTATG pLKO_005 585 CDS 100% 10.800 15.120 N Tspan12 n/a
2 TRCN0000381670 ATTACGGCTTACCGAGGTATA pLKO_005 655 CDS 100% 10.800 15.120 N Tspan12 n/a
3 TRCN0000127025 GCCAGTACAGTGGTCAGATAT pLKO.1 608 CDS 100% 13.200 9.240 N Tspan12 n/a
4 TRCN0000351598 GCCAGTACAGTGGTCAGATAT pLKO_005 608 CDS 100% 13.200 9.240 N Tspan12 n/a
5 TRCN0000382046 GGATGAGGGACTACCTGAATA pLKO_005 346 CDS 100% 13.200 9.240 N Tspan12 n/a
6 TRCN0000127026 CCAAGTCTTTCAAGGATCTTT pLKO.1 1086 CDS 100% 5.625 3.938 N Tspan12 n/a
7 TRCN0000351633 CCAAGTCTTTCAAGGATCTTT pLKO_005 1086 CDS 100% 5.625 3.938 N Tspan12 n/a
8 TRCN0000127024 CGGAAGTATTAACTACAGAAT pLKO.1 1982 3UTR 100% 4.950 3.465 N Tspan12 n/a
9 TRCN0000351634 CGGAAGTATTAACTACAGAAT pLKO_005 1982 3UTR 100% 4.950 3.465 N Tspan12 n/a
10 TRCN0000127028 TCTCAGCACTTGTCATGTCAT pLKO.1 1047 CDS 100% 4.950 3.465 N Tspan12 n/a
11 TRCN0000351326 TCTCAGCACTTGTCATGTCAT pLKO_005 1047 CDS 100% 4.950 3.465 N Tspan12 n/a
12 TRCN0000127027 GCTTCCTTATCATCGTGGGAA pLKO.1 460 CDS 100% 2.640 1.848 N Tspan12 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017321602.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07900 pDONR223 100% 89.3% 97.3% None (many diffs) n/a
2 ccsbBroad304_07900 pLX_304 0% 89.3% 97.3% V5 (many diffs) n/a
3 TRCN0000467958 AGAATATGTGCTATGTTAGCTGCA pLX_317 41.2% 89.3% 97.3% V5 (many diffs) n/a
Download CSV