Construct: ORF TRCN0000468186
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF013384.1_s317c1
- Derived from:
- ccsbBroadEn_03284
- DNA Barcode:
- ATCCCGTTAGTCGAGTAATCCAAT
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- SPG21 (51324)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000468186
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 51324 | SPG21 | SPG21 abhydrolase domain co... | NM_001127889.5 | 100% | 100% | |
| 2 | human | 51324 | SPG21 | SPG21 abhydrolase domain co... | NM_016630.7 | 100% | 100% | |
| 3 | human | 51324 | SPG21 | SPG21 abhydrolase domain co... | XM_005254437.4 | 100% | 100% | |
| 4 | human | 51324 | SPG21 | SPG21 abhydrolase domain co... | XM_017022297.1 | 100% | 100% | |
| 5 | human | 51324 | SPG21 | SPG21 abhydrolase domain co... | XM_017022298.1 | 100% | 100% | |
| 6 | human | 51324 | SPG21 | SPG21 abhydrolase domain co... | NM_001127890.5 | 91.2% | 91.2% | 225_226ins81 |
| 7 | mouse | 27965 | Spg21 | SPG21, maspardin | NM_138584.2 | 87.8% | 97.7% | (many diffs) |
| 8 | mouse | 27965 | Spg21 | SPG21, maspardin | XM_006511222.3 | 87.8% | 97.7% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 990
- ORF length:
- 924
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatggg agagattaaa gtctctcctg attataactg gtttagaggt acagttcccc 121 ttaaaaagat tattgtggat gatgatgaca gtaagatatg gtcgctctat gacgcgggcc 181 cccgaagtat caggtgtcct ctcatattcc tgccccctgt cagtggaact gcagatgtct 241 ttttccggca gattttggct ctgactggat ggggttaccg ggttatcgct ttgcagtatc 301 cagtttattg ggaccatctc gagttctgtg atggattcag aaaactttta gaccatttac 361 aattggataa agttcatctt tttggcgctt ctttgggagg ctttttggcc cagaaatttg 421 ctgaatacac tcacaaatct cctagagtcc attccctaat cctctgcaat tccttcagtg 481 acacctctat cttcaaccaa acttggactg caaacagctt ttggctgatg cctgcattta 541 tgctcaaaaa aatagttctt ggaaattttt catctggccc ggtggaccct atgatggctg 601 atgccattga tttcatggta gacaggctag aaagttTGGG TCAGAGTGAA CTGGCTTCAA 661 GACTTACCTT GAATTGTCAA AATTCTTATG TGGAACCTCA TAAAATTCGG GACATACCTG 721 TAACTATTAT GGATGTGTTT GATCAGAGTG CGCTTTCAAC TGAAGCTAAA GAAGAAATGT 781 ACAAGCTGTA TCCTAATGCC CGAAGAGCTC ATCTGAAAAC AGGAGGCAAT TTCCCATACC 841 TGTGCAGAAG TGCAGAGGTC AATCTTTATG TACAGATACA TTTGCTGCAA TTCCATGGAA 901 CCAAATACGC GGCCATTGAC CCATCAATGG TCAGTGCCGA GGAGCTTGAG GTGCAGAAAG 961 GCAGCCTTGG CATCAGCCAG GAGGAGCAGT ACCCAACTTT CTTGTACAAA GTGGTTGATA 1021 TCGGTAAGCC TATCCCTAAC CCTCTCCTCG GTCTCGATTC TACGTAGTAA TGAACTAGTC 1081 CGTAACTTGA AAGTATTTCG ATTTCTTGGC TTTATATATC TTGTGGAAAG GACGAATCCC 1141 GTTAGTCGAG TAATCCAATA CGCGTTAAGT Cgacaatcaa cctctggatt acaaaatttg 1201 tgaaagatt