Transcript: Human NM_001127890.5

Homo sapiens SPG21 abhydrolase domain containing, maspardin (SPG21), transcript variant 3, mRNA.

Source:
NCBI, updated 2019-08-08
Taxon:
Homo sapiens (human)
Gene:
SPG21 (51324)
Length:
1718
CDS:
275..1120

Additional Resources:

NCBI RefSeq record:
NM_001127890.5
NBCI Gene record:
SPG21 (51324)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001127890.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000304152 ATGATGATGACAGTAAGATAT pLKO_005 348 CDS 100% 13.200 9.240 N SPG21 n/a
2 TRCN0000083159 CGGGACATACCTGTAACTATT pLKO.1 836 CDS 100% 13.200 9.240 N SPG21 n/a
3 TRCN0000217440 GTGCAGAGGTCAATCTTTATG pLKO.1 978 CDS 100% 13.200 9.240 N Spg21 n/a
4 TRCN0000304153 TATCAGGTGTCCTCTCATATT pLKO_005 397 CDS 100% 13.200 9.240 N SPG21 n/a
5 TRCN0000083160 GCTTCAAGACTTACCTTGAAT pLKO.1 782 CDS 100% 0.563 0.394 N SPG21 n/a
6 TRCN0000083158 CCTGTGTAACTGTTCCCTCTT pLKO.1 1292 3UTR 100% 4.050 2.430 N SPG21 n/a
7 TRCN0000331677 CCTGTGTAACTGTTCCCTCTT pLKO_005 1292 3UTR 100% 4.050 2.430 N SPG21 n/a
8 TRCN0000083161 CTTCAAGACTTACCTTGAATT pLKO.1 783 CDS 100% 0.000 0.000 N SPG21 n/a
9 TRCN0000300854 CTTCAAGACTTACCTTGAATT pLKO_005 783 CDS 100% 0.000 0.000 N SPG21 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001127890.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03284 pDONR223 100% 91.2% 91.2% None 225_226ins81 n/a
2 ccsbBroad304_03284 pLX_304 0% 91.2% 91.2% V5 225_226ins81 n/a
3 TRCN0000468186 ATCCCGTTAGTCGAGTAATCCAAT pLX_317 38.5% 91.2% 91.2% V5 225_226ins81 n/a
Download CSV