Construct: ORF TRCN0000468228
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF007078.3_s317c1
- Derived from:
- ccsbBroadEn_09665
- DNA Barcode:
- GCAGAGATGTTATTCGGAGACCGA
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- SIK1 (150094)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000468228
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 102724428 | SIK1B | salt inducible kinase 1B (p... | NM_001320643.3 | 100% | 100% | |
| 2 | human | 150094 | SIK1 | salt inducible kinase 1 | NM_173354.5 | 99.9% | 99.8% | 1844C>T;1848C>T |
| 3 | human | 102724428 | SIK1B | salt inducible kinase 1B (p... | XM_017028208.1 | 93.7% | 93.7% | 967_968ins147 |
| 4 | human | 150094 | SIK1 | salt inducible kinase 1 | XM_011529474.2 | 93.6% | 93.6% | 967_968ins147;1697C>T;1701C>T |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 2415
- ORF length:
- 2349
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatggt tatcatgtcg gagttcagcg cggaccccgc gggccagggt cagggccagc 121 agaagcccct ccgggtgggt ttttacgaca tcgagcggac cctgggcaaa ggcaacttcg 181 cggtggtgaa gctggcgcgg catcgagtca ccaaaacgca ggttgcaata aaaataattg 241 ataaaacacg attagattca agcaatttgg agaaaatcta tcgtgaggtt cagctgatga 301 agcttctgaa ccatccacac atcataaagc tttaccaggt tatggaaaca aaggacatgc 361 tttacatcgt cactgaattt gctaaaaatg gagaaatgtt tgattatttg acttccaacg 421 ggcacctgag tgagaacgag gcgcggaaga agttctggca aatcctgtcg gccgtggagt 481 actgtcacga ccatcacatc gtccaccggg acctcaagac cgagaacctc ctgctggatg 541 gcaacatgga catcaagctg gcagattttg gatttgggaa tttctacaag tcaggagagc 601 ctctgtccac gtggtgtggg agccccccgt atgccgcccc ggaagtcttt gaggggaagg 661 agtatgaagg cccccagctg gacatctgga gcctgggcgt ggtgctgtac gtcctggtct 721 gcggttctct ccccttcgat gggcctaacc tgccgacgct gagacagcgg gtgctggagg 781 gccgcttccg catccccttc ttcatgtctc aagactgtga gagcctgatc cgccgcatgc 841 tggtggtgga ccccgccagg cgcatcacca tcgcccagat ccggcagcac cggtggatgc 901 gggctgagcc ctgcttgccg ggacccgcct gccccgcctt ctccgcacac agctacacct 961 ccaacctggg cgactacgat gagcaggcgc tgggtatcat gcagaccctg ggcgtggacc 1021 ggcagaggac ggtggagtca ctgcaaaaca gcagctataa ccactttgct gccatttatt 1081 acctcctcct tgagcggctc aaggagtatc ggaatgccca gtgcgcccgc cccgggcctg 1141 ccaggcagcc gcggcctcgg agctcggacc tcagtggttt ggaggtgcct caggaaggtc 1201 tttccaccga ccctttccga cctgccttgc tgtgcccgca gccgcagacc ttggtgcagt 1261 ccgtcctcca ggccgagatg gactgtgagc tccagagctc gctgcagtgg cccttgttct 1321 tcccggtgga tgccagctgc agcggagtgt tccggccccg gcccgtgtcc ccaagcagcc 1381 tgctggacac agccatcagt gaggaggcca ggcaggggcc gggcctagag gaggagcagg 1441 acacgcagga gtccctgccc agcagcacgg gccggaggca caccctggcc gaggtctcca 1501 cccgcctctc cccactcacc gcgccatgta tagtcgtctc cccctccacc acggcaagtc 1561 ctgcagaggg aaccagctct gacagttgtc tgaccttctc tgcgagcaaa agccccgcgg 1621 ggctcagtgg caccccggcc actcaggggc tgctgggcgc ctgctccccg gtcaggctgg 1681 cctcgccctt cctggggtcg cagtccgcca ccccagtgct gcaggctcag gggggcttgg 1741 gaggagctgt tctgctccct gtcagcttcc aggagggacg gcgggcgtcg gacacctcac 1801 tgactcaagg gctgaaggcc tttcggcagc agctgaggaa gaccacgcgg accaaagggt 1861 ttctgggact gaacaaaatc aaggggctgg ctcgccaggt gtgccaggtc cctgccagcc 1921 gggccagcag gggcggcctg agccccttcc acgccCCTGC ACAGAGCCCA GGCCTGCACG 1981 GCGGCGCAGC CGGCAGCCGG GAGGGCTGGA GCCTGCTGGA GGAGGTGCTA GAGCAGCAGA 2041 GGCTGCTCCA GTTACAGCAC CACCCGGCCG CTGCACCCGG CTGCTCCCAG GCCCCCCAGC 2101 CGGCCCCTGC CCCGTTTGTG ATCGCCCCCT GTGATGGCCC TGGGGCTGCC CCGCTCCCCA 2161 GCACCCTCCT CACGTCGGGG CTCCCGCTGC TGCCGCCCCC ACTCCTGCAG ACCGGCGCGT 2221 CCCCGGTGGC CTCAGCGGCG CAGCTCCTGG ACACACACCT GCACATTGGC ACCGGCCCCA 2281 CCGCCCTCCC CGCTGTGCCC CCACCACGCC TGGCCAGGCT GGCCCCAGGT TGTGAGCCCC 2341 TGGGGCTGCT GCAGGGGGAC TGTGAGATGG AGGACCTGAT GCCCTGCTCC CTAGGCACGT 2401 TTGTCCTGGT GCAGTGCCCA ACTTTCTTGT ACAAAGTGGT TGATATCGGT AAGCCTATCC 2461 CTAACCCTCT CCTCGGTCTC GATTCTACGT AGTAATGAAC TAGTCCGTAA CTTGAAAGTA 2521 TTTCGATTTC TTGGCTTTAT ATATCTTGTG GAAAGGACGA GCAGAGATGT TATTCGGAGA 2581 CCGAACGCGT TAAGTCgaca atcaacctct ggattacaaa atttgtgaaa gatt