Construct: ORF TRCN0000468344
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF002657.1_s317c1
- Derived from:
- ccsbBroadEn_11985
- DNA Barcode:
- GTATCTAGCAACGCACGCGAGGTC
- Epitope Tag:
- V5 (not translated due to prior stop codon)
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- AMOTL2 (51421)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000468344
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 51421 | AMOTL2 | angiomotin like 2 | NM_001363943.2 | 59.8% | 59.8% | 1_939del |
| 2 | human | 51421 | AMOTL2 | angiomotin like 2 | XM_006713654.3 | 59.8% | 59.8% | 1_939del |
| 3 | human | 51421 | AMOTL2 | angiomotin like 2 | NM_016201.4 | 59.7% | 59.7% | 1_939del;2102_2104delCAG |
| 4 | human | 51421 | AMOTL2 | angiomotin like 2 | XM_017006580.1 | 59.7% | 59.7% | 1_939del;2102_2104delCAG |
| 5 | human | 51421 | AMOTL2 | angiomotin like 2 | XM_017006581.1 | 59.7% | 59.7% | 1_939del;2102_2104delCAG |
| 6 | human | 51421 | AMOTL2 | angiomotin like 2 | XM_017006582.1 | 59.7% | 59.7% | 1_939del;2102_2104delCAG |
| 7 | human | 51421 | AMOTL2 | angiomotin like 2 | NM_001278685.2 | 59.5% | 59.5% | 1_939del;1572_1573insCAGAGA |
| 8 | human | 51421 | AMOTL2 | angiomotin like 2 | NM_001278683.1 | 55.6% | 55.6% | 1_1113del |
| 9 | mouse | 56332 | Amotl2 | angiomotin-like 2 | NM_019764.2 | 51.2% | 53.2% | (many diffs) |
| 10 | mouse | 56332 | Amotl2 | angiomotin-like 2 | XM_006511771.3 | 51.2% | 53.2% | (many diffs) |
| 11 | mouse | 56332 | Amotl2 | angiomotin-like 2 | XM_006511773.2 | 51.2% | 53.2% | (many diffs) |
| 12 | mouse | 56332 | Amotl2 | angiomotin-like 2 | XM_006511772.2 | 49.7% | 51.6% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 1464
- ORF length:
- 1398
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 tgggcatgga ggccgtgctg agggagaatg ccaggctgca gagagacaat gagcggctgc 121 agagggagct ggagagctct gcggagaagg ctggccgcat tgagaagctg gaaagcgaaa 181 tccagcggct ctctgaggcc catgagagcc tgaccagagc ctcctccaag cgtgaggccc 241 tggagaagac catgcggaac aagatggaca gtgaaatgag gaggctgcaa gacttcaacc 301 gggatcttag agagagattg gaatctgcaa atcgccgcct ggcaagcaag acacaggagg 361 cccaggccgg cagtcaggac atggtggcca agctgcttgc tcagagctac gaacagcagc 421 aggagcaaga gaagctggag cgagagatgg cactgctgcg cggcgccatc gaggaccagc 481 ggcggcgtgc cgagctgctg gagcaggctc tgggcaatgc gcagggccgg gcagctcgag 541 ccgaagagga gctgcgcaag aagcaggcct atgtggagaa agtggagcgg ctgcagcagg 601 cgctcgggca gctgcaggca gcctgtgaga agcgggagca gctggagctg cgtctgcgga 661 ctcgcctgga gcaggaactc aaggccctgc gtgcacagca gagacaggca ggtgccccag 721 gtggtagcag tggcagtggt gggtctccag agctcagcgc cctgcgactg tcagaacaac 781 tgcgagagaa ggaggagcag atcctggcgc tggaggccga catgaccaag tgggagcaga 841 agtatttgga ggaacgtgcc atgaggcagt ttgccatgga tgcggctgcc acggctgctg 901 ctcagcgtga caccactctc atccgacatt ccccccagcc ctcacccagc agcagcttca 961 atgagggtct gctcactggt ggccacaggc atcaggagat ggaaagcagg ttaaaggtgc 1021 tccatgccca gatcctggag aaggatgcag tgatcaaggT CCTTCAGCAG CGCTCCAGGA 1081 GAGACCCTGG CAAGGCCATC CAGGGCTCCC TGCGGCCTGC CAAGTCGGTG CCATCTGTTT 1141 TCGCGGCTGC GGCAGCAGGA ACCCAGGGCT GGCAAGGGCT CTCTTCTAGT GAGCGACAAA 1201 CAGCAGACGC CCCTGCTCGG CTGACTACAG ACAGAGCACC CACAGAGGAG CCAGTGGTCA 1261 CAGCTCCCCC TGCTGCCCAT GCCAAACACG GGAGCAGAGA TGGGAGCACC CAGACTGAGG 1321 GCCCCCCAGA CAGCACCTCC ACCTGCCTGC CACCGGAGCC TGACAGCCTT CTGGGGTGCA 1381 GCAGTAGCCA GAGAGCAGCC TCTCTGGACT CTGTAGCTAC ATCCAGAGTC CAGGACTTGT 1441 CAGACATGGT GGAGATACTG ATCCTGCCCA ACTTTCTTGT ACAAAGTGGT TGATATCGGT 1501 AAGCCTATCC CTAACCCTCT CCTCGGTCTC GATTCTACGT AGTAATGAAC TAGTCCGTAA 1561 CTTGAAAGTA TTTCGATTTC TTGGCTTTAT ATATCTTGTG GAAAGGACGA GTATCTAGCA 1621 ACGCACGCGA GGTCACGCGT TAAGTCgaca atcaacctct ggattacaaa atttgtgaaa 1681 gatt