Construct: ORF TRCN0000468532
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF013663.1_s317c1
- Derived from:
- ccsbBroadEn_08816
- DNA Barcode:
- TAAGTTAATCCCTAACACATGACA
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- CIDEC (63924)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000468532
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
---|---|---|---|---|---|---|---|---|
1 | human | 63924 | CIDEC | cell death inducing DFFA li... | NM_001199552.2 | 99.8% | 100% | 33C>G |
2 | human | 63924 | CIDEC | cell death inducing DFFA li... | NM_001321142.2 | 99.8% | 100% | 33C>G |
3 | human | 63924 | CIDEC | cell death inducing DFFA li... | NM_022094.3 | 99.8% | 100% | 33C>G |
4 | human | 63924 | CIDEC | cell death inducing DFFA li... | XM_024453700.1 | 99.8% | 100% | 33C>G |
5 | human | 63924 | CIDEC | cell death inducing DFFA li... | NM_001199551.1 | 95.8% | 95.9% | 33C>G;206_235del |
6 | human | 63924 | CIDEC | cell death inducing DFFA li... | NM_001199623.1 | 94.6% | 94.8% | 1_39del;72C>G |
7 | human | 63924 | CIDEC | cell death inducing DFFA li... | NM_001321143.2 | 68.9% | 68.9% | 0_1ins222 |
8 | human | 63924 | CIDEC | cell death inducing DFFA li... | NM_001321144.2 | 68.9% | 68.9% | 0_1ins222 |
9 | human | 152302 | CIDECP1 | cell death inducing DFFA li... | NR_002786.1 | 37.1% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 780
- ORF length:
- 714
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatgga atacgccatg aagtccctta gccttctgta ccccaagtcc ctctccaggc 121 atgtgtcagt gcgtacctct gtggtgaccc agcagctgct gtcggagccc agccccaagg 181 cccccagggc ccggccctgc cgcgtaagca cggcggatcg aagcgtgagg aagggcatca 241 tggcttacag tcttgaggac ctcctcctca aggtccggga cactctgatg ctggcagaca 301 agcccttctt cctggtgctg gaggaagatg gcacaactgt agagacagaa gagtacttcc 361 aagccctggc aggggataca gtgttcatgg TCCTCCAGAA GGGGCAGAAA TGGCAGCCCC 421 CATCAGAACA GGGGACAAGG CACCCACTGT CCCTCTCCCA TAAGCCTGCC AAGAAGATTG 481 ATGTGGCCCG TGTAACGTTT GATCTGTACA AGCTGAACCC ACAGGACTTC ATTGGCTGCC 541 TGAACGTGAA GGCGACTTTT TATGATACAT ACTCCCTTTC CTATGATCTG CACTGCTGTG 601 GGGCCAAGCG CATCATGAAG GAAGCTTTCC GCTGGGCCCT CTTCAGCATG CAGGCCACAG 661 GCCACGTACT GCTTGGCACC TCCTGTTACC TGCAGCAGCT CCTCGATGCT ACGGAGGAAG 721 GGCAGCCCCC CAAGGGCAAG GCCTCATCCC TTATCCCGAC CTGTCTGAAG ATACTGCAGT 781 GCCCAACTTT CTTGTACAAA GTGGTTGATA TCGGTAAGCC TATCCCTAAC CCTCTCCTCG 841 GTCTCGATTC TACGTAGTAA TGAACTAGTC CGTAACTTGA AAGTATTTCG ATTTCTTGGC 901 TTTATATATC TTGTGGAAAG GACGATAAGT TAATCCCTAA CACATGACAA CGCGTTAAGT 961 Cgacaatcaa cctctggatt acaaaatttg tgaaagatt