Transcript: Human NM_001321142.2

Homo sapiens cell death inducing DFFA like effector c (CIDEC), transcript variant 5, mRNA.

Source:
NCBI, updated 2019-06-02
Taxon:
Homo sapiens (human)
Gene:
CIDEC (63924)
Length:
1305
CDS:
169..885

Additional Resources:

NCBI RefSeq record:
NM_001321142.2
NBCI Gene record:
CIDEC (63924)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001321142.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000154802 GAGGAAGATGGCACAACTGTA pLKO.1 424 CDS 100% 4.950 3.465 N CIDEC n/a
2 TRCN0000151104 GTTTGATCTGTACAAGCTGAA pLKO.1 600 CDS 100% 4.050 2.835 N CIDEC n/a
3 TRCN0000155826 CATGGCTTACAGTCTTGAGGA pLKO.1 342 CDS 100% 2.640 1.848 N CIDEC n/a
4 TRCN0000150556 GATACATACTCCCTTTCCTAT pLKO.1 667 CDS 100% 4.950 2.970 N CIDEC n/a
5 TRCN0000155048 GCGCATCATGAAGGAAGCTTT pLKO.1 711 CDS 100% 4.950 2.970 N CIDEC n/a
6 TRCN0000152978 GAGACAGAAGAGTACTTCCAA pLKO.1 445 CDS 100% 3.000 1.800 N CIDEC n/a
7 TRCN0000154914 GATCTGTACAAGCTGAACCCA pLKO.1 604 CDS 100% 0.750 0.450 N CIDEC n/a
8 TRCN0000155669 CCCTTTCCTATGATCTGCACT pLKO.1 677 CDS 100% 2.640 1.320 Y CIDEC n/a
9 TRCN0000155400 CCTGTCTGAAGATACTGCAGT pLKO.1 863 CDS 100% 2.640 1.320 Y CIDEC n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001321142.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_08816 pDONR223 100% 99.8% 100% None 33C>G n/a
2 ccsbBroad304_08816 pLX_304 0% 99.8% 100% V5 33C>G n/a
3 TRCN0000468532 TAAGTTAATCCCTAACACATGACA pLX_317 54.4% 99.8% 100% V5 33C>G n/a
4 TRCN0000492236 TATGTGAAGTACACATGGCCCGTC pLX_317 53.8% 99.8% 100% V5 (not translated due to prior stop codon) 33C>G n/a
Download CSV