Construct: ORF TRCN0000468538
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF003947.1_s317c1
- Derived from:
- ccsbBroadEn_09979
- DNA Barcode:
- TCGACCCACCACTCAGAGCGTCTG
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- DCAF4L1 (285429)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000468538
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- n/a
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 285429 | DCAF4L1 | DDB1 and CUL4 associated fa... | NM_001029955.4 | 99.9% | 100% | 309C>T |
| 2 | human | 26094 | DCAF4 | DDB1 and CUL4 associated fa... | NM_181340.3 | 84.8% | 76.7% | (many diffs) |
| 3 | human | 26094 | DCAF4 | DDB1 and CUL4 associated fa... | XM_017021214.1 | 70.9% | 64.1% | (many diffs) |
| 4 | human | 26094 | DCAF4 | DDB1 and CUL4 associated fa... | NM_015604.4 | 67.8% | 61.2% | (many diffs) |
| 5 | human | 26094 | DCAF4 | DDB1 and CUL4 associated fa... | XM_017021207.1 | 67.8% | 61.2% | (many diffs) |
| 6 | human | 26094 | DCAF4 | DDB1 and CUL4 associated fa... | XM_017021208.1 | 67.8% | 61.2% | (many diffs) |
| 7 | human | 26094 | DCAF4 | DDB1 and CUL4 associated fa... | XM_017021215.2 | 60.6% | 55% | (many diffs) |
| 8 | human | 26094 | DCAF4 | DDB1 and CUL4 associated fa... | NM_001352447.2 | 60.5% | 54.9% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 69
- ORF end:
- 1257
- ORF length:
- 1188
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcaccat ggaggctgaa aggctgcgac tcctcgagga agaggccaag ctgaaaaagg 121 tagccagaat gggatttaat gcatcttcca tgctccgaaa aagccagcta ggtttcctca 181 acgtcaccag ttactcccgt ttagccaacg agctgcgtgt gagctgcatg gagcggaaaa 241 aggtccaaat tcggagcttg gatccctcct ctttggcgag cgaccgattt aacttcattc 301 tggcgagtac caacagcgac cagctcttcg tagtgaacca ggtcgaagtc gaaggctcca 361 agtacggcat catcagtctg cgaactctga agatcccttc gttccacgtg tacgtgctca 421 gaaacctcta cgtccccaac cggaaggtga agtccctgtg ctgggcctcg ctgaaccagt 481 tggactctca cgttctgctg tgcttcgagg gaatcacaga tgctccaagc tgtgcagtgc 541 tgctcccagc gtcgcggttc ttaagtgttc acacaagagt taaccagcct ggcatgctct 601 gcagtttcca gatcccagag gcctggtcct gtgcgtggtc cctcaacacc cgggcatatc 661 actgctttag tgcaggcttg tctcagcagg tcctgttgac cagcgtggcg acgggacacc 721 agcagtcatt tgataccagc agtgatgtct tggcccagca gtttgctagt acggctcctt 781 tgctgtttaa tggctgtcgc tccggggaga tctttgccat tgatctgcgt tgtagaaatc 841 gaggcaaggg gtggagggcc actcgcctgt tccatgactc agcagtgacc tctgtgcaaa 901 tccTCCAAGA AGAGCAATGC CTGATGGCAT CAGACATGAC TGGAAAGATC AAGCTGTGGG 961 ATCTGAGGGC CACTAAATGT GTAAGGCAGT ACGAAGGTCA CGTGAATGAG TCCGCCTATC 1021 TGCCCCTGCA TGTGCACGAG GAAGAGGGAA TCGTGGTGGC AGTGGGCCAG GACTGCTACA 1081 CGAGAATCTG GAGCCTCCAT GATGCCCACC TGCTCAGAAC CATCCCTTCC CCGTACTCTG 1141 CCTCCGAGGA CGACATTCCC AGCGTGGCCT TCGCTTCTCG GCTCGGGGGC ATCCGGGGAG 1201 CAGCACCAGG GCTGCTCATG GCTGTCCGGC AGGACCTTTA TTGTTTCCCC TTCAGCTTGC 1261 CAACTTTCTT GTACAAAGTG GTTGATATCG GTAAGCCTAT CCCTAACCCT CTCCTCGGTC 1321 TCGATTCTAC GTAGTAATGA ACTAGTCCGT AACTTGAAAG TATTTCGATT TCTTGGCTTT 1381 ATATATCTTG TGGAAAGGAC GATCGACCCA CCACTCAGAG CGTCTGACGC GTTAAGTCga 1441 caatcaacct ctggattaca aaatttgtga aagatt