Transcript: Human NM_181340.3

Homo sapiens DDB1 and CUL4 associated factor 4 (DCAF4), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-06-01
Taxon:
Homo sapiens (human)
Gene:
DCAF4 (26094)
Length:
2374
CDS:
289..1476

Additional Resources:

NCBI RefSeq record:
NM_181340.3
NBCI Gene record:
DCAF4 (26094)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_181340.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000156172 CGTCAATAGTCACCCAGGAAT pLKO.1 780 CDS 100% 4.950 6.435 N DCAF4 n/a
2 TRCN0000434536 AGATTGCCAGGATGGGATTTA pLKO_005 338 CDS 100% 13.200 10.560 N DCAF4 n/a
3 TRCN0000419932 GATTTGACTTACGGGAGTAAA pLKO_005 1506 3UTR 100% 13.200 10.560 N DCAF4 n/a
4 TRCN0000152743 GCATCACTGTTCGTCAATAGT pLKO.1 769 CDS 100% 5.625 4.500 N DCAF4 n/a
5 TRCN0000152474 CGGTGACTTGAATGTCAGATT pLKO.1 2173 3UTR 100% 4.950 3.960 N DCAF4 n/a
6 TRCN0000150332 CCCTGAATATCCAAGCAAATA pLKO.1 860 CDS 100% 13.200 9.240 N DCAF4 n/a
7 TRCN0000153029 GTCCCTGAATATCCAAGCAAA pLKO.1 858 CDS 100% 4.950 3.465 N DCAF4 n/a
8 TRCN0000155781 CCTCATACTGGCAGATACCAA pLKO.1 513 CDS 100% 3.000 2.100 N DCAF4 n/a
9 TRCN0000153155 GCTGGAGTTTGGAATCCTTAA pLKO.1 1980 3UTR 100% 10.800 6.480 N DCAF4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_181340.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07989 pDONR223 100% 99.9% 100% None 1137G>A n/a
2 ccsbBroad304_07989 pLX_304 0% 99.9% 100% V5 1137G>A n/a
3 TRCN0000479479 TTTCTGAAATAATCGATTCCCTGC pLX_317 29.9% 99.9% 100% V5 1137G>A n/a
4 ccsbBroadEn_09979 pDONR223 100% 84.8% 76.7% None (many diffs) n/a
5 ccsbBroad304_09979 pLX_304 0% 84.8% 76.7% V5 (many diffs) n/a
6 TRCN0000468538 TCGACCCACCACTCAGAGCGTCTG pLX_317 30% 84.8% 76.7% V5 (many diffs) n/a
7 ccsbBroadEn_07988 pDONR223 100% 79.5% 79.1% None (many diffs) n/a
8 ccsbBroad304_07988 pLX_304 0% 79.5% 79.1% V5 (many diffs) n/a
9 TRCN0000468468 AGTACTCTCGGCCAATGATATGAT pLX_317 22.7% 79.5% 79.1% V5 (many diffs) n/a
Download CSV