Construct: ORF TRCN0000468630
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF012328.1_s317c1
- Derived from:
- ccsbBroadEn_01972
- DNA Barcode:
- GGCAATCCTACTACGTTCGGCGCT
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- HSD17B6 (8630)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000468630
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
---|---|---|---|---|---|---|---|---|
1 | human | 8630 | HSD17B6 | hydroxysteroid 17-beta dehy... | NM_003725.4 | 100% | 100% | |
2 | human | 8630 | HSD17B6 | hydroxysteroid 17-beta dehy... | XM_005269207.1 | 100% | 100% | |
3 | human | 8630 | HSD17B6 | hydroxysteroid 17-beta dehy... | XM_005269208.1 | 100% | 100% | |
4 | human | 8630 | HSD17B6 | hydroxysteroid 17-beta dehy... | XM_005269209.1 | 100% | 100% | |
5 | human | 8630 | HSD17B6 | hydroxysteroid 17-beta dehy... | XM_006719672.1 | 100% | 100% | |
6 | human | 8630 | HSD17B6 | hydroxysteroid 17-beta dehy... | XM_011538925.1 | 100% | 100% | |
7 | human | 8630 | HSD17B6 | hydroxysteroid 17-beta dehy... | XM_011538926.1 | 100% | 100% | |
8 | human | 8630 | HSD17B6 | hydroxysteroid 17-beta dehy... | XM_011538927.1 | 100% | 100% | |
9 | human | 8630 | HSD17B6 | hydroxysteroid 17-beta dehy... | XM_024449249.1 | 78.8% | 75.4% | (many diffs) |
10 | human | 8630 | HSD17B6 | hydroxysteroid 17-beta dehy... | XM_024449250.1 | 78.8% | 75.4% | (many diffs) |
11 | human | 8630 | HSD17B6 | hydroxysteroid 17-beta dehy... | XM_024449251.1 | 78.8% | 75.4% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 1017
- ORF length:
- 951
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatgtg gctctacctg gcggccttcg tgggcctgta ctaccttctg cactggtacc 121 gggagaggca ggtggtgagc cacctccaag acaagtatgt ctttatcacg ggctgtgact 181 cgggctttgg gaacctgctg gccagacagc tggatgcacg aggcttgaga gtgctggctg 241 cgtgtctgac ggagaagggg gccgagcagc tgaggggcca gacgtctgac aggctggaga 301 cggtgaccct ggatgttacc aagatggaga gcatcgctgc agctactcag tgggtgaagg 361 agcatgtggg ggacagagga ctctggggac tggtgaacaa tgcaggcatt cttacaccaa 421 ttaccttatg tgagtggctg aacactgagg actctatgaa tatgctcaaa gtgaacctca 481 ttggtgtgat ccaggtgacc ttgagcatgc ttcctttggt gaggagagca cggggaagaa 541 ttgtcaatgt ctccagcatt ctgggaagag ttgctttctt tgtaggaggc tactgtgtct 601 ccaagtatgg agtggaagcc ttttcagata ttctgaggcg tgagattcaa cattttgggg 661 tgaaaatcag catagttgaa cctggctact tCAGAACGGG AATGACAAAC ATGACACAGT 721 CCTTAGAGCG AATGAAGCAA AGTTGGAAAG AAGCCCCCAA GCATATTAAG GAGACCTATG 781 GACAGCAGTA TTTTGATGCC CTTTACAATA TCATGAAGGA AGGGCTGTTG AATTGTAGCA 841 CAAACCTGAA CCTGGTCACT GACTGCATGG AACATGCTCT GACATCGGTG CATCCGCGAA 901 CTCGATATTC AGCTGGCTGG GATGCTAAAT TTTTCTTCAT CCCTCTATCT TATTTACCTA 961 CATCACTGGC AGACTACATT TTGACTAGAT CTTGGCCCAA ACCAGCCCAG GCAGTCTACC 1021 CAACTTTCTT GTACAAAGTG GTTGATATCG GTAAGCCTAT CCCTAACCCT CTCCTCGGTC 1081 TCGATTCTAC GTAGTAATGA ACTAGTCCGT AACTTGAAAG TATTTCGATT TCTTGGCTTT 1141 ATATATCTTG TGGAAAGGAC GAGGCAATCC TACTACGTTC GGCGCTACGC GTTAAGTCga 1201 caatcaacct ctggattaca aaatttgtga aagatt