Transcript: Human XM_024449250.1

PREDICTED: Homo sapiens hydroxysteroid 17-beta dehydrogenase 6 (HSD17B6), transcript variant X9, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
HSD17B6 (8630)
Length:
1874
CDS:
360..1139

Additional Resources:

NCBI RefSeq record:
XM_024449250.1
NBCI Gene record:
HSD17B6 (8630)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_024449250.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000049469 GCAGGCATTCTTACACCAATT pLKO.1 696 CDS 100% 10.800 7.560 N HSD17B6 n/a
2 TRCN0000292063 GCAGGCATTCTTACACCAATT pLKO_005 696 CDS 100% 10.800 7.560 N HSD17B6 n/a
3 TRCN0000049472 CGAATGAAGCAAAGTTGGAAA pLKO.1 1023 CDS 100% 4.950 3.465 N HSD17B6 n/a
4 TRCN0000292064 CGAATGAAGCAAAGTTGGAAA pLKO_005 1023 CDS 100% 4.950 3.465 N HSD17B6 n/a
5 TRCN0000049468 GCCTTATTAAACAGAGTAGAT pLKO.1 1679 3UTR 100% 4.950 3.465 N HSD17B6 n/a
6 TRCN0000292154 GCCTTATTAAACAGAGTAGAT pLKO_005 1679 3UTR 100% 4.950 3.465 N HSD17B6 n/a
7 TRCN0000049470 GCTGTTGAATTGTAGCACAAA pLKO.1 1231 3UTR 100% 4.950 3.465 N HSD17B6 n/a
8 TRCN0000292060 GCTGTTGAATTGTAGCACAAA pLKO_005 1231 3UTR 100% 4.950 3.465 N HSD17B6 n/a
9 TRCN0000049471 CCTCCAAGACAAGTATGTCTT pLKO.1 437 CDS 100% 0.495 0.347 N HSD17B6 n/a
10 TRCN0000292061 CCTCCAAGACAAGTATGTCTT pLKO_005 437 CDS 100% 0.495 0.347 N HSD17B6 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_024449250.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01972 pDONR223 100% 78.8% 75.4% None (many diffs) n/a
2 ccsbBroad304_01972 pLX_304 0% 78.8% 75.4% V5 (many diffs) n/a
3 TRCN0000468630 GGCAATCCTACTACGTTCGGCGCT pLX_317 34.6% 78.8% 75.4% V5 (many diffs) n/a
Download CSV