Construct: ORF TRCN0000468633
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF004178.1_s317c1
- Derived from:
- ccsbBroadEn_15930
- DNA Barcode:
- CAGGGTCTCGCCGTAACCCGTAGA
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- PMEPA1 (56937)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000468633
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 56937 | PMEPA1 | prostate transmembrane prot... | NM_199170.3 | 99.8% | 100% | 291A>G |
| 2 | human | 56937 | PMEPA1 | prostate transmembrane prot... | NM_199171.2 | 99.8% | 100% | 291A>G |
| 3 | human | 56937 | PMEPA1 | prostate transmembrane prot... | NM_199169.3 | 93.9% | 94% | 1_45del;336A>G |
| 4 | human | 56937 | PMEPA1 | prostate transmembrane prot... | NM_001255976.2 | 91.3% | 91.5% | 1_66del;357A>G |
| 5 | human | 56937 | PMEPA1 | prostate transmembrane prot... | NM_020182.5 | 82.4% | 82.5% | 1_150del;441A>G |
| 6 | mouse | 65112 | Pmepa1 | prostate transmembrane prot... | NM_022995.3 | 70.5% | 74.5% | (many diffs) |
| 7 | mouse | 65112 | Pmepa1 | prostate transmembrane prot... | XM_006499991.3 | 62.2% | 65.7% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 777
- ORF length:
- 711
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatgat ggtgatggtg gtggtgatca cgtgcctgct gagccactac aagctgtctg 121 cacggtcctt catcagccgg cacagccagg ggcggaggag agaagatgcc ctgtcctcag 181 aaggatgcct gtggccctcg gagagcacag tgtcaggcaa cggaatccca gagccgcagg 241 tctacgcccc gcctcggccc accgaccgcc tggccgtgcc gcccttcgcc cagcgggagc 301 gcttccaccg cttccagccc acctatccgt acctgcagca cgagatcgac ctgccgccca 361 ccatctcgct gtcagacggg GAGGAGCCCC CACCCTACCA GGGCCCCTGC ACCCTCCAGC 421 TTCGGGACCC CGAGCAGCAG CTGGAACTGA ACCGGGAGTC GGTGCGCGCA CCCCCAAACA 481 GAACCATCTT CGACAGTGAC CTGATGGATA GTGCCAGGCT GGGCGGCCCC TGCCCCCCCA 541 GCAGTAACTC GGGCATCAGC GCCACGTGCT ACGGCAGCGG CGGGCGCATG GAGGGGCCGC 601 CGCCCACCTA CAGCGAGGTC ATCGGCCACT ACCCGGGGTC CTCCTTCCAG CACCAGCAGA 661 GCAGTGGGCC GCCCTCCTTG CTGGAGGGGA CCCGGCTCCA CCACACACAC ATCGCGCCCC 721 TAGAGAGCGC AGCCATCTGG AGCAAAGAGA AGGATAAACA GAAAGGACAC CCTCTCTACC 781 CAACTTTCTT GTACAAAGTG GTTGATATCG GTAAGCCTAT CCCTAACCCT CTCCTCGGTC 841 TCGATTCTAC GTAGTAATGA ACTAGTCCGT AACTTGAAAG TATTTCGATT TCTTGGCTTT 901 ATATATCTTG TGGAAAGGAC GACAGGGTCT CGCCGTAACC CGTAGAACGC GTTAAGTCga 961 caatcaacct ctggattaca aaatttgtga aagatt