Transcript: Human NM_199171.2

Homo sapiens prostate transmembrane protein, androgen induced 1 (PMEPA1), transcript variant 4, mRNA.

Source:
NCBI, updated 2019-06-04
Taxon:
Homo sapiens (human)
Gene:
PMEPA1 (56937)
Length:
4645
CDS:
255..968

Additional Resources:

NCBI RefSeq record:
NM_199171.2
NBCI Gene record:
PMEPA1 (56937)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_199171.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000000331 GTCCCTATGAATTGTACGTTT pLKO.1 4152 3UTR 100% 4.950 6.930 N PMEPA1 n/a
2 TRCN0000272492 GTCCCTATGAATTGTACGTTT pLKO_005 4152 3UTR 100% 4.950 6.930 N PMEPA1 n/a
3 TRCN0000284770 ACAGTGTCAGGCAACGGAATC pLKO_005 396 CDS 100% 6.000 4.200 N PMEPA1 n/a
4 TRCN0000000335 GAGTTTGTTCAGATCATCATC pLKO.1 222 5UTR 100% 4.950 3.465 N PMEPA1 n/a
5 TRCN0000272440 GAGTTTGTTCAGATCATCATC pLKO_005 222 5UTR 100% 4.950 3.465 N PMEPA1 n/a
6 TRCN0000000333 GATAAACAGAAAGGACACCCT pLKO.1 942 CDS 100% 0.660 0.462 N PMEPA1 n/a
7 TRCN0000000334 GAGCAAAGAGAAGGATAAACA pLKO.1 929 CDS 100% 5.625 3.375 N PMEPA1 n/a
8 TRCN0000272494 GAGCAAAGAGAAGGATAAACA pLKO_005 929 CDS 100% 5.625 3.375 N PMEPA1 n/a
9 TRCN0000375416 TGTATTAGAAGAGGCCTATTC pLKO_005 1421 3UTR 100% 10.800 7.560 N Pmepa1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_199171.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_15930 pDONR223 0% 99.8% 100% None 291A>G n/a
2 ccsbBroad304_15930 pLX_304 0% 99.8% 100% V5 291A>G n/a
3 TRCN0000468633 CAGGGTCTCGCCGTAACCCGTAGA pLX_317 55.6% 99.8% 100% V5 291A>G n/a
4 ccsbBroadEn_08669 pDONR223 100% 93.6% 93.6% None (many diffs) n/a
5 ccsbBroad304_08669 pLX_304 0% 93.6% 93.6% V5 (many diffs) n/a
6 TRCN0000476124 CTACGCGCCACTCAGTCGTTCACT pLX_317 43.6% 93.6% 93.6% V5 (many diffs) n/a
Download CSV