Construct: ORF TRCN0000468694
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF002318.1_s317c1
- Derived from:
- ccsbBroadEn_12137
- DNA Barcode:
- TAGAGTAAACGTGTTCCATCCCCG
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- ANKRD40CL (55018)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000468694
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 55018 | ANKRD40CL | ANKRD40 C-terminal like | XM_024450816.1 | 100% | 100% | |
| 2 | human | 55018 | ANKRD40CL | ANKRD40 C-terminal like | XM_024450817.1 | 100% | 100% | |
| 3 | human | 55018 | ANKRD40CL | ANKRD40 C-terminal like | XM_024450818.1 | 100% | 100% | |
| 4 | human | 55018 | ANKRD40CL | ANKRD40 C-terminal like | XM_024450819.1 | 100% | 100% | |
| 5 | human | 55018 | ANKRD40CL | ANKRD40 C-terminal like | XR_002958045.1 | 62.6% | 1_69del;532_737del | |
| 6 | human | 55018 | ANKRD40CL | ANKRD40 C-terminal like | XR_002958044.1 | 61.3% | 1_69del;532_753del | |
| 7 | human | 55018 | ANKRD40CL | ANKRD40 C-terminal like | XR_002958043.1 | 54.7% | 1_69del;532_844del |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 69
- ORF end:
- 531
- ORF length:
- 462
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcaccat ggggaggagg agtccattca aaccgagaaa caaagtgttt ggtttttctt 121 acccctggtg tagaagctac caaccttttc caagaaagag ggcctggccc ccttctcggg 181 tctggctggg tgcctgctgt gcctctctgg cctcccctcc gaagggcacc attccctcgg 241 gtgagtacta ccggcctgca ccgtcttcca gtggggacag cctgagaaga gagtctggag 301 ccttacttca gtaccttcct tcactggcct caccctgtgc aaatcatgcc acacgctgca 361 gcctcctttt ccctatcTAT AAAATAAAAA TGACCCTGCT CTATCTCACT GGGCTGGCAA 421 GAACACACTG TTGTTACCTT GCAGACAGAT GTGCTGAGGC TGTAGAAAGT GCTTTTTATT 481 TGGTTGGGAG CTTGTGCATA AATGCGAGAG GGGCTGCACA TCTGACGGAC TTGCCAACTT 541 TCTTGTACAA AGTGGTTGAT ATCGGTAAGC CTATCCCTAA CCCTCTCCTC GGTCTCGATT 601 CTACGTAGTA ATGAACTAGT CCGTAACTTG AAAGTATTTC GATTTCTTGG CTTTATATAT 661 CTTGTGGAAA GGACGATAGA GTAAACGTGT TCCATCCCCG ACGCGTTAAG TCgacaatca 721 acctctggat tacaaaattt gtgaaagatt