Transcript: Human XR_002958045.1

PREDICTED: Homo sapiens ANKRD40 C-terminal like (ANKRD40CL), transcript variant X5, misc_RNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
ANKRD40CL (55018)
Length:
737
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_002958045.1
NBCI Gene record:
ANKRD40CL (55018)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XR_002958045.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000163077 GTGTAGAAGCTACCAACCTTT pLKO.1 129 3UTR 100% 4.950 6.930 N ANKRD40CL n/a
2 TRCN0000165974 GATGTGCTGAGGCTGTAGAAA pLKO.1 449 3UTR 100% 5.625 3.938 N ANKRD40CL n/a
3 TRCN0000166538 CTTCAGTACCTTCCTTCACTG pLKO.1 307 3UTR 100% 4.050 2.835 N ANKRD40CL n/a
4 TRCN0000164210 CCTTACTTCAGTACCTTCCTT pLKO.1 302 3UTR 100% 3.000 2.100 N ANKRD40CL n/a
5 TRCN0000166670 CTGAGGCTGTAGAAAGTGCTT pLKO.1 455 3UTR 100% 2.640 1.848 N ANKRD40CL n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_002958045.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_12137 pDONR223 100% 62.6% None 1_69del;532_737del n/a
2 ccsbBroad304_12137 pLX_304 0% 62.6% V5 1_69del;532_737del n/a
3 TRCN0000468694 TAGAGTAAACGTGTTCCATCCCCG pLX_317 33.8% 62.6% V5 1_69del;532_737del n/a
Download CSV