Construct: ORF TRCN0000468699
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF001806.1_s317c1
- Derived from:
- ccsbBroadEn_05234
- DNA Barcode:
- GACGATCCAATCGCGACGTGTACT
- Epitope Tag:
- V5 (not translated due to frame shift)
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- TBCEL (219899)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000468699
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
---|---|---|---|---|---|---|---|---|
1 | human | 219899 | TBCEL | tubulin folding cofactor E ... | NM_001130047.2 | 100% | 100% | |
2 | human | 219899 | TBCEL | tubulin folding cofactor E ... | NM_001363644.1 | 100% | 100% | |
3 | human | 219899 | TBCEL | tubulin folding cofactor E ... | NM_152715.4 | 100% | 100% | |
4 | mouse | 272589 | Tbcel | tubulin folding cofactor E-... | NM_173038.3 | 88.9% | 97.4% | (many diffs) |
5 | mouse | 272589 | Tbcel | tubulin folding cofactor E-... | XM_006510394.3 | 88.9% | 97.4% | (many diffs) |
6 | mouse | 272589 | Tbcel | tubulin folding cofactor E-... | XM_006510393.2 | 85.2% | 93.4% | (many diffs) |
7 | mouse | 272589 | Tbcel | tubulin folding cofactor E-... | XM_006510395.3 | 62.5% | 65.3% | (many diffs) |
8 | mouse | 272589 | Tbcel | tubulin folding cofactor E-... | XM_006510396.3 | 62.5% | 65.3% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 69
- ORF end:
- 1341
- ORF length:
- 1272
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcaccat ggatcaacct agtggaagaa gtttcatgca agtattatgt gaaaaatata 121 gtcctgaaaa ttttccttat cgccgtggcc cggggatggg agtccatgtc ccagccacac 181 ctcagggctc tcctatgaaa gatcgcctca acctcccaag tgtactagtg ttgaacagct 241 gtggaataac ctgtgcagga gatgaaaaag aaattgctgc tttctgcgct catgtgtcgg 301 aactagatct ttctgacaac aaactcgaag actggcatga ggtcagtaaa attgtgtcaa 361 atgttcctca gttggagttt ctaaacctga gttccaaccc tctgaatttg tcggttttag 421 aaagaacatg tgctgggtcc ttctctgggg ttcgcaaact tgtcctcaac aacagcaaag 481 cttcttggga gacggtccac atgatactac aggagttacc agatttggag gagctcttcc 541 tgtgccttaa tgactatgaa acagtgtctt gtccttctat ttgctgtcat tctcttaagc 601 tactacatat aacagacaat aacctccaag actggactga aatacgaaag ttaggagtta 661 tgtttccttc actggatacc ctcgtcctgg ccaacaatca tttgaatgct attgaggagc 721 ctgatgattc attggccagg ttgtttccta atcttcgatc catcagcctc cacaagtcag 781 gtttgcagtc ctgggaagac attgataaac taaattcatt tcccaaactg gaagaagtga 841 gattgttagg aattccTCTT CTGCAGCCAT ATACCACCGA GGAGCGAAGG AAATTGGTAA 901 TAGCCAGATT GCCATCAGTT TCCAAACTTA ATGGCAGCGT TGTTACTGAT GGTGAACGAG 961 AAGATTCTGA GAGATTTTTT ATTCGTTACT ATGTGGATGT TCCACAGGAA GAAGTGCCAT 1021 TCAGGTATCA TGAACTGATC ACTAAATATG GGAAGTTGGA GCCTTTGGCA GAAGTGGACC 1081 TAAGACCCCA GAGCAGTGCA AAAGTAGAAG TCCACTTTAA CGATCAGGTG GAAGAAATGA 1141 GCATTCGTCT GGACCAAACA GTGGCAGAAC TAAAGAAACA GTTAAAAACT CTAGTACAAT 1201 TACCCACAAG CAACATGCTT CTCTACTATT TTGACCATGA AGCACCCTTT GGCCCAGAGG 1261 AAATGAAGTA CAGCTCTCGG GCATTGCATT CCTTTGGCAT TAGGGATGGA GATAAAATTT 1321 ACGTGGAATC CAAAACAAAA TTCCAACTTT CTTGTACAAA GTGGTTGATA TCGGTAAGCC 1381 TATCCCTAAC CCTCTCCTCG GTCTCGATTC TACGTAGTAA TGAACTAGTC CGTAACTTGA 1441 AAGTATTTCG ATTTCTTGGC TTTATATATC TTGTGGAAAG GACGAGACGA TCCAATCGCG 1501 ACGTGTACTA CGCGTTAAGT Cgacaatcaa cctctggatt acaaaatttg tgaaagatt