Construct: ORF TRCN0000468728
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF014960.1_s317c1
- Derived from:
- ccsbBroadEn_13233
- DNA Barcode:
- TGATACGCCGGGCCGCCCACTTTC
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- MGAT5B (146664)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000468728
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- n/a
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 146664 | MGAT5B | alpha-1,6-mannosylglycoprot... | XM_006721707.3 | 26.1% | 24.6% | (many diffs) |
| 2 | human | 146664 | MGAT5B | alpha-1,6-mannosylglycoprot... | XM_011524350.3 | 25.2% | 23.8% | (many diffs) |
| 3 | human | 146664 | MGAT5B | alpha-1,6-mannosylglycoprot... | NM_144677.3 | 24.1% | 22.7% | (many diffs) |
| 4 | human | 146664 | MGAT5B | alpha-1,6-mannosylglycoprot... | NM_001199172.2 | 24.1% | 22.7% | (many diffs) |
| 5 | human | 146664 | MGAT5B | alpha-1,6-mannosylglycoprot... | NM_198955.1 | 23.8% | 22.4% | (many diffs) |
| 6 | human | 146664 | MGAT5B | alpha-1,6-mannosylglycoprot... | XR_934377.3 | 13.2% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 657
- ORF length:
- 591
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatggc agggcccccg acggctgggc cttctcccgc cccatgtgtc tgcccatccc 121 tcccacaggt agacccctac ctaccctacg agtacacctg cgaggggatg ctggagcgga 181 tccacgccta catccagcac caggacttct gcagagctcc agaccctgcc ctaccagagg 241 cccacgcccc gcagagcccc tttgtcctgg cccccaatgc cacccacctc gagtgggctc 301 ggaacaccag cttggctcct ggggcctggc cccccgcgca cgccctgcgg gcctggctgg 361 ccgtgcctgg gagggcctgc accgacacct gcctggacca cgggcTAATC TGTGAGCCCT 421 CCTTCTTCCC CTTCCTGAAC AGCCAGGACG CCTTCCTCAA GCTGCAGGTG CCCTGTGACA 481 GCACCGAGTC GGAGATGAAC CACCTGTACC CGGCGTTCGC CCAGCCTGGC CAGGAGTGCT 541 ACCTGCAGAA GGAGCCTCTG CTCTTCAGCT GCGCCGGCTC CAACACCAAG TACCGCCGGC 601 TCTGCCCCTG CCGCGACTTC CGCAAGGGCC AGGTGGCCTT GTGCCAGGGC TGTCTGTGCC 661 CAACTTTCTT GTACAAAGTG GTTGATATCG GTAAGCCTAT CCCTAACCCT CTCCTCGGTC 721 TCGATTCTAC GTAGTAATGA ACTAGTCCGT AACTTGAAAG TATTTCGATT TCTTGGCTTT 781 ATATATCTTG TGGAAAGGAC GATGATACGC CGGGCCGCCC ACTTTCACGC GTTAAGTCga 841 caatcaacct ctggattaca aaatttgtga aagatt