Transcript: Human XM_011524350.3

PREDICTED: Homo sapiens alpha-1,6-mannosylglycoprotein 6-beta-N-acetylglucosaminyltransferase B (MGAT5B), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
MGAT5B (146664)
Length:
4318
CDS:
505..2772

Additional Resources:

NCBI RefSeq record:
XM_011524350.3
NBCI Gene record:
MGAT5B (146664)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011524350.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000035505 GCCATTATGAGAACTCAGGTA pLKO.1 2224 CDS 100% 2.640 3.696 N MGAT5B n/a
2 TRCN0000286734 GCCATTATGAGAACTCAGGTA pLKO_005 2224 CDS 100% 2.640 3.696 N MGAT5B n/a
3 TRCN0000035504 GCCAAACTCTTCATCGGGTTT pLKO.1 1972 CDS 100% 4.050 3.240 N MGAT5B n/a
4 TRCN0000035506 CCTGGGCATCCTGAACAAATA pLKO.1 1836 CDS 100% 13.200 9.240 N MGAT5B n/a
5 TRCN0000294131 ACATTCTGACTGCACTCTATG pLKO_005 1349 CDS 100% 10.800 7.560 N MGAT5B n/a
6 TRCN0000294082 AGCAGTTCATGACCATGTTTC pLKO_005 1664 CDS 100% 10.800 7.560 N MGAT5B n/a
7 TRCN0000035508 CATGGGACTCTCCTTCAAGAA pLKO.1 1524 CDS 100% 4.950 3.465 N MGAT5B n/a
8 TRCN0000286735 CATGGGACTCTCCTTCAAGAA pLKO_005 1524 CDS 100% 4.950 3.465 N MGAT5B n/a
9 TRCN0000294133 AGACTTGCAAGGGAGAGGAAC pLKO_005 3157 3UTR 100% 4.050 2.835 N MGAT5B n/a
10 TRCN0000035507 CGTCTCCGACATCGCTGTGAA pLKO.1 774 CDS 100% 1.650 1.155 N MGAT5B n/a
11 TRCN0000428466 CGTACAACCACGAGGAGTATG pLKO_005 1592 CDS 100% 10.800 15.120 N Mgat5b n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011524350.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_13233 pDONR223 100% 25.2% 23.8% None (many diffs) n/a
2 ccsbBroad304_13233 pLX_304 0% 25.2% 23.8% V5 (many diffs) n/a
3 TRCN0000468728 TGATACGCCGGGCCGCCCACTTTC pLX_317 42.8% 25.2% 23.8% V5 (many diffs) n/a
Download CSV