Construct: ORF TRCN0000468790
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF015700.1_s317c1
- Derived from:
- ccsbBroadEn_07746
- DNA Barcode:
- TTAAATAGCTGAGCCATTCAATTC
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- WDR5 (11091)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000468790
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
---|---|---|---|---|---|---|---|---|
1 | human | 11091 | WDR5 | WD repeat domain 5 | NM_017588.3 | 99.9% | 100% | 606A>G |
2 | human | 11091 | WDR5 | WD repeat domain 5 | NM_052821.3 | 99.9% | 100% | 606A>G |
3 | human | 11091 | WDR5 | WD repeat domain 5 | XM_005272163.2 | 99.9% | 100% | 606A>G |
4 | human | 11091 | WDR5 | WD repeat domain 5 | XM_024447393.1 | 99.9% | 100% | 606A>G |
5 | human | 11091 | WDR5 | WD repeat domain 5 | XM_024447394.1 | 99.9% | 100% | 606A>G |
6 | human | 11091 | WDR5 | WD repeat domain 5 | XM_024447395.1 | 99.9% | 100% | 606A>G |
7 | human | 54554 | WDR5B | WD repeat domain 5B | NM_019069.4 | 79.7% | 85% | (many diffs) |
8 | human | 401127 | LOC401127 | WD repeat domain 5 pseudogene | NR_026854.1 | 54.5% | (many diffs) | |
9 | mouse | 140858 | Wdr5 | WD repeat domain 5 | NM_080848.2 | 87.6% | 100% | (many diffs) |
10 | mouse | 140858 | Wdr5 | WD repeat domain 5 | XM_006497672.3 | 87.6% | 100% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 1068
- ORF length:
- 1002
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatggc gacggaggag aagaagcccg agaccgaggc cgccagagca cagccaaccc 121 cttcgtcatc cgccactcag agcaagccta cacctgtgaa gccaaactat gctctaaagt 181 tcacccttgc tggccacacc aaagcagtgt cctccgtgaa attcagcccg aatggagagt 241 ggctggcaag ttcatctgct gataaactta ttaaaatttg gggcgcgtat gatgggaaat 301 ttgagaaaac catatctggt cacaagctgg gaatatccga tgtagcctgg tcgtcagatt 361 ctaaccttct tgtttctgcc tcagatgaca aaaccttgaa gatatgggac gtgagctcgg 421 gcaagtgtct gaaaaccctg aagggacaca gtaattatgt cttttgctgc aacttcaatc 481 cccagtccaa ccttattgtc tcaggatcct ttgacgaaag cgtgaggata tgggatgtga 541 aaacagggaa gtgcctcaag actttgccag ctcactcgga tccagtctcg gccgttcatt 601 ttaatcgtga tggatccttg atagtttcaa gtagctatga tggtctctgt cgcatctggG 661 ACACCGCCTC GGGCCAGTGC CTGAAGACGC TCATCGATGA CGACAACCCC CCCGTGTCTT 721 TTGTGAAGTT CTCCCCGAAC GGCAAATACA TCCTGGCCGC CACGCTGGAC AACACTCTGA 781 AGCTCTGGGA CTACAGCAAG GGGAAGTGCC TGAAGACGTA CACTGGCCAC AAGAATGAGA 841 AATACTGCAT ATTTGCCAAT TTCTCTGTTA CTGGTGGGAA GTGGATTGTG TCTGGCTCAG 901 AGGATAACCT TGTTTACATC TGGAACCTTC AGACGAAAGA GATTGTACAG AAACTACAAG 961 GCCACACAGA TGTCGTGATC TCAACAGCTT GTCACCCAAC AGAAAACATC ATCGCCTCTG 1021 CTGCGCTAGA AAATGACAAA ACAATTAAAC TGTGGAAGAG TGACTGCTAC CCAACTTTCT 1081 TGTACAAAGT GGTTGATATC GGTAAGCCTA TCCCTAACCC TCTCCTCGGT CTCGATTCTA 1141 CGTAGTAATG AACTAGTCCG TAACTTGAAA GTATTTCGAT TTCTTGGCTT TATATATCTT 1201 GTGGAAAGGA CGATTAAATA GCTGAGCCAT TCAATTCACG CGTTAAGTCg acaatcaacc 1261 tctggattac aaaatttgtg aaagatt